Busch Lab

ZMP

scel

Ensembl ID:
ENSDARG00000034677
ZFIN ID:
ZDB-GENE-030616-15
Description:
sciellin [Source:RefSeq peptide;Acc:NP_001005304]
Human Orthologue:
SCEL
Human Description:
sciellin [Source:HGNC Symbol;Acc:10573]
Mouse Orthologue:
Scel
Mouse Description:
sciellin Gene [Source:MGI Symbol;Acc:MGI:1891228]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa13716 Essential Splice Site Available for shipment Available now
sa12635 Essential Splice Site Available for shipment Available now
sa21456 Essential Splice Site Available for shipment Available now
sa21457 Nonsense Available for shipment Available now
sa41387 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13716
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048548 Essential Splice Site 177 572 10 29
ENSDART00000075926 Essential Splice Site 177 612 10 32

The following transcripts of ENSDARG00000034677 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 17833107)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17309177
GRCz11 9 17316889
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGYATTGAGGGTCTCTGTATRTCTCATTGCACATGTTATCTGTTCCTAAA[G/A]TGACTACAAAACAACAARACAAGAGGACAWCACTGTGAAGTCATCAAAGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3732
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048548 Essential Splice Site 208 572 11 29
ENSDART00000075926 Essential Splice Site 208 612 11 32

The following transcripts of ENSDARG00000034677 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 17833305)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17309375
GRCz11 9 17317087
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTAATTCTTTTTGTGTAGACCGTCTTCACCTGTCAAGACCACTACAAGG[T/A]AGAGTAAGCATAGCCNTTTTTTTNAAATATCTGACTGTGATTTCTTTGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12635
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048548 Essential Splice Site 266 572 15 29
ENSDART00000075926 Essential Splice Site 296 612 17 32

The following transcripts of ENSDARG00000034677 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 17840017)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17316087
GRCz11 9 17323799
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTTTCTGCATTTGTATATTAAAATTCAACCTATCATTCTTTTTGTTTA[G/T]GCCAACTTCACCTGTCAAGACCACCACTAGGTACAGTTACAGCTAMCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21456
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048548 Essential Splice Site 276 572 None 29
ENSDART00000075926 Essential Splice Site 306 612 None 32

The following transcripts of ENSDARG00000034677 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 17840150)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17316220
GRCz11 9 17323932
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTCTATAAAAAGTTGTCTACTCTTAGAACATTTAAACTATTTTAATTAC[A/T]GCATCAAAACCTTCACCAAGGAGGATGTTTCACCAGCTAAATCAACAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21457
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048548 Nonsense 302 572 17 29
ENSDART00000075926 Nonsense 332 612 19 32

The following transcripts of ENSDARG00000034677 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 17840394)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17316464
GRCz11 9 17324176
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGACTAAAATGTTGATCCCTATATATTTTTGTGTGTCTAAAGTGACTA[C/A]AAGACTGAAGTGGCTACTGTGAAGTCATCAAAGGACATCATTGATATGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3727
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048548 Essential Splice Site 352 572 None 29
ENSDART00000075926 Essential Splice Site 382 612 None 32

The following transcripts of ENSDARG00000034677 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 17843477)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17319547
GRCz11 9 17327259
KASP Assay ID:
2260-1671.1 (used for ordering genotyping assays)
KASP Sequence:
ATGTTACATCCCCTAAAACAACACCATATTCTGTGCGCTCCACAAAGAGG[T/A]GAGAKATCCTTAAAGAAAACTTCATGCTCAAGTCATTGCAAGACAAAGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27374
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048548 Nonsense 492 572 26 29
ENSDART00000075926 Nonsense 532 612 29 32

The following transcripts of ENSDARG00000034677 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 17848155)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17324225
GRCz11 9 17331937
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGAATACATGTCGGATTCTCTCACATCAAAAACTACTACGACTGTATA[C/A]TCATCACCGGAAAGGTATGGAGGCGGAAATAGTTTTCATTTAATTAAGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7178
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048548 Essential Splice Site 497 572 26 29
ENSDART00000075926 Essential Splice Site 537 612 29 32

The following transcripts of ENSDARG00000034677 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 17848170)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17324240
GRCz11 9 17331952
KASP Assay ID:
554-4546.1 (used for ordering genotyping assays)
KASP Sequence:
GATTCTCTCACATCAAAAACTACTACGACTGTRTACTCATCACCGGAAAG[G/A]TATGGAGGCGGAAATAGTTTTCATTTAATTAAGTTATGCGTATAGTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41387
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048548 Essential Splice Site 567 572 28 29
ENSDART00000075926 Essential Splice Site 607 612 31 32

The following transcripts of ENSDARG00000034677 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 17850276)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17326346
GRCz11 9 17334058
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTTTACCAGTGTGCGATTCACTGTGCAAGCTGCTTTGGTGTCACTAAGA[G/A]TAAGAAAACTCTATACAACTACATTTTTCAGTATTCTGAAACAAATAGTC
Associated Phenotype:
Not determined