Busch Lab

ZMP

slc1a8a

Ensembl ID:
ENSDARG00000034628
ZFIN ID:
ZDB-GENE-101111-8
Description:
Excitatory amino acid transporter SLC1A8a [Source:UniProtKB/TrEMBL;Acc:D7RVS6]
Human Orthologue:
SLC1A7
Human Description:
solute carrier family 1 (glutamate transporter), member 7 [Source:HGNC Symbol;Acc:10945]
Mouse Orthologue:
Slc1a7
Mouse Description:
solute carrier family 1 (glutamate transporter), member 7 Gene [Source:MGI Symbol;Acc:MGI:2444087]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa16384 Nonsense Available for shipment Available now
sa16033 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27750
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040105 Nonsense 310 598 6 11
Genomic Location (Zv9):
Chromosome 11 (position 15225780)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15019227
GRCz11 11 15076886
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGGTAAAATGGGTGAACGGGGAGCTCCTCTGGTGAACGTTTGCCAGTG[C/A]ATCAATGAATGCGTGATGAAGATCATTAATGCAGCAGTTTGGTAAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16384
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040105 Nonsense 417 598 8 11
ENSDART00000040105 Nonsense 417 598 8 11
Genomic Location (Zv9):
Chromosome 11 (position 15231713)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15013294
GRCz11 11 15070953
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACAGTTCAGCAACACTTCCCATTACAAYGAAATGTTTRTTGGAGAACTG[T/A]CGAGTGGACAGGCAGWTTGCTCGATTTGTGCTGCCAGTGGGAGCAACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16033
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040105 Nonsense 417 598 8 11
ENSDART00000040105 Nonsense 417 598 8 11
Genomic Location (Zv9):
Chromosome 11 (position 15231713)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15013294
GRCz11 11 15070953
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACAGTTCAGCAACACTTCCCATTACAAYGAAATGTTTRTTGGAGAACTG[T/A]CGAGTGGACAGGCAGWTTGCTCGATTTGTGCTGCCAGTGGGAGCAACCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3807
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040105 Splice Site, Nonsense 512 598 9 11
ENSDART00000040105 Splice Site, Nonsense 512 598 9 11
Genomic Location (Zv9):
Chromosome 11 (position 15232185)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15012822
GRCz11 11 15070481
KASP Assay ID:
2260-4080.1 (used for ordering genotyping assays)
KASP Sequence:
CGGATTGCCACCAGATGACATCACTCTGATTGTGGCCMTTGATTGGATCT[T/A]GTAAGTTGAGATAACATTTATCTTTTGAAAAAAAGAAAGATCATATCTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19004
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040105 Splice Site, Nonsense 512 598 9 11
ENSDART00000040105 Splice Site, Nonsense 512 598 9 11
Genomic Location (Zv9):
Chromosome 11 (position 15232185)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15012822
GRCz11 11 15070481
KASP Assay ID:
2260-4080.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGATTGCCACCAGATGACATCACTCTGATTGTGGCCATTGATTGGATCT[T/A]GTAAGTTGAGATAACATTTATCTTTTGAAAAAAAGAAAGATCATATCTTA
Associated Phenotype:
Not determined