Busch Lab

ZMP

scn4ab

Ensembl ID:
ENSDARG00000034588
ZFIN ID:
ZDB-GENE-051201-1
Description:
Sodium channel protein type 4 subunit alpha B [Source:UniProtKB/Swiss-Prot;Acc:Q20JQ7]
Human Orthologue:
SCN4A
Human Description:
sodium channel, voltage-gated, type IV, alpha subunit [Source:HGNC Symbol;Acc:10591]
Mouse Orthologue:
Scn4a
Mouse Description:
sodium channel, voltage-gated, type IV, alpha Gene [Source:MGI Symbol;Acc:MGI:98250]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa26050 Nonsense Mutation detected in F1 DNA Not yet available
sa18126 Essential Splice Site Available for shipment Available now
sa33152 Nonsense Available for shipment Available now
sa18528 Nonsense Available for shipment Available now
sa13421 Nonsense Available for shipment Available now
sa40056 Nonsense Mutation detected in F1 DNA Not yet available
sa25245 Nonsense Mutation detected in F1 DNA Not yet available
sa13450 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26050
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044157 Nonsense 237 1784 6 24
ENSDART00000104004 Nonsense 236 1784 6 24
Genomic Location (Zv9):
Chromosome 3 (position 22492443)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 22148834
GRCz11 3 22279382
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAAGAATGTGTCAGCTAAGATTGTGTTTAATTGTGAATTACAGGTCTA[A/T]AAACCATTGTTGGGGCCCTAATTCAGTCAGTAAAGAAACTGGCGGATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18126
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044157 Essential Splice Site 390 1784 8 24
ENSDART00000104004 Essential Splice Site 389 1784 8 24
Genomic Location (Zv9):
Chromosome 3 (position 22494795)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 22151186
GRCz11 3 22281734
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTTTTCCGGCTCATGACTCAAGATTTCTGGGAGAACTTGTTCCAGTTG[G/A]TAGGTATATGCATCCTGTTGGATTCTTATTCCTTGCCATCTTWCATGTTY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33152
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044157 Nonsense 466 1784 10 24
ENSDART00000104004 Nonsense 465 1784 10 24
Genomic Location (Zv9):
Chromosome 3 (position 22496572)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 22152963
GRCz11 3 22283511
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCCTGTTTTCATGTCACGCAGCAGAAGAACGGGATGGTAAATGGCAGC[A/T]AGACATCCCTGTCAAGCAAAAAGAAAGGTGATAATGATCAAATGCAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18528
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044157 Nonsense 484 1784 10 24
ENSDART00000104004 Nonsense 483 1784 10 24
Genomic Location (Zv9):
Chromosome 3 (position 22496628)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 22153019
GRCz11 3 22283567
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCCTGTCAAGCAAAAAGAAAGGTGAYAATGATCAAATGCAAAGYGACTA[T/A]GATGGGATTGCATTGAAACCCCTCTCGAAATCCAATGGATCYAAAGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13421
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044157 Nonsense 758 1784 13 24
ENSDART00000104004 Nonsense 757 1784 13 24
Genomic Location (Zv9):
Chromosome 3 (position 22502188)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 22158579
GRCz11 3 22289127
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCCTCATCATCTTTCGTGTTCTGTGCGGCGAGTGGATTGAAACTATGTG[G/A]GACTGCATGGAGGTGGCTGGTCAAGGCATGTGCAKCATCGTCTTCATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40056
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044157 Nonsense 1004 1784 17 24
ENSDART00000104004 Nonsense 1003 1784 17 24
Genomic Location (Zv9):
Chromosome 3 (position 22513447)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 22169838
GRCz11 3 22300386
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTTATTTAGGCTTTTGAGGACATTTACATTGAACAGCGGAGAATGATT[A/T]AGATCATCCTTGAATATGCAGACCAGGTCTTCACCTATGTGTTTGTGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25245
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044157 Nonsense 1016 1784 17 24
ENSDART00000104004 Nonsense 1015 1784 17 24
Genomic Location (Zv9):
Chromosome 3 (position 22513485)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 22169876
GRCz11 3 22300424
KASP Assay ID:
554-7823.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGAGAATGATTAAGATCATCCTTGAATATGCAGACCAGGTCTTCACCTA[T/A]GTGTTTGTGGTTGAGATGCTTTTGAAATGGGTGGCCTATGGTTTCAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13450
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044157 Nonsense 1523 1784 24 24
ENSDART00000104004 Nonsense 1523 1784 24 24
Genomic Location (Zv9):
Chromosome 3 (position 22527208)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 22183599
GRCz11 3 22314147
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGAGGAAACTGTGGGAACGCRGCGGTGGGCATYGTGTTCTTCTGCAGCTA[C/A]ATYGTCATGTCCTTCCTCGTYGTKGTCAACATGTAYATAGCCATTATCCW
Associated Phenotype:
Not determined