Busch Lab

ZMP

atp6v1al

Ensembl ID:
ENSDARG00000034534
ZFIN ID:
ZDB-GENE-040426-1143
Description:
V-type proton ATPase catalytic subunit A [Source:RefSeq peptide;Acc:NP_957429]
Human Orthologue:
ATP6V1A
Human Description:
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A [Source:HGNC Symbol;Acc:851]
Mouse Orthologue:
Atp6v1a
Mouse Description:
ATPase, H+ transporting, lysosomal V1 subunit A Gene [Source:MGI Symbol;Acc:MGI:1201780]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa20406 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20406
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049003 Nonsense 40 617 3 15
Genomic Location (Zv9):
Chromosome 5 (position 25915519)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23742784
GRCz11 5 24246584
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTATTCAATACAGTGGTGACGGCCTCCAGCATGGCAGGTGCAGCTATGTA[T/A]GAACTGGTTCGTGTCGGCCACAGTGAGCTGGTGGGAGAGATTATCCGATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8183
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049003 Nonsense 569 617 14 15
Genomic Location (Zv9):
Chromosome 5 (position 25925786)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23753051
GRCz11 5 24256851
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCATGCTGTCGAGACCACAGCTCAGAGCGATAACAARATCACCTGGGCA[C/T]AGATCCGTGAACACATGGGAGAAATTYTGTATCGGATCAGCTCCATGAAG
Associated Phenotype:
Not determined