Busch Lab

ZMP

rab6ba

Ensembl ID:
ENSDARG00000034522
ZFIN ID:
ZDB-GENE-050809-136
Description:
ras-related protein Rab-6B [Source:RefSeq peptide;Acc:NP_001029351]
Human Orthologue:
RAB6B
Human Description:
RAB6B, member RAS oncogene family [Source:HGNC Symbol;Acc:14902]
Mouse Orthologue:
Rab6b
Mouse Description:
RAB6B, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:107283]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa5753 Nonsense F2 line generated Not yet available
sa2309 Nonsense F2 line generated Not yet available
sa14349 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5753
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049177 Nonsense 22 208 1 8
ENSDART00000127126 Nonsense 72 258 1 8
ENSDART00000049177 Nonsense 22 208 1 8
ENSDART00000127126 Nonsense 72 258 1 8
Genomic Location (Zv9):
Chromosome 6 (position 27375757)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27676968
GRCz11 6 27667529
KASP Assay ID:
554-3060.1 (used for ordering genotyping assays)
KASP Sequence:
ATGACTTTGGAAACCCTTTAAGGAAATTCAAACTCGTCTTTCTTGGAGAG[C/T]AAAGCGGTGAGTGTCATAWTGGAATTTCCTAAGGAAGTTTTGATGATAAG
Long Flanking Sequence:
AAGTGAACTACCCCTGACTGGGATGCAGACTTTATAGTACAGTACTCTAGGTTTTAACCATGCACTATTCAACCCCAAGCACCATTCAATCAATTTTAAAAGCCATAAATAAATGTATAATAGAAAACAGTATGTTATAAAAAGCACAAACCTTCCGTAGCTTAATGTGGGCAATAATATGACATCATGTTCTGTGGGCTGATACAGCATGACGTCAGGCTCTGTGGGTTGATACAGCACTACGTCGTGTGTGTGCATGAGAGTGAGAGAGCGAGGTGAGGCCGCGCATGCGCAAACAGCCCTTCAGTCTGACAGCCGATCCAGTGCAGCATTCCCGTCTCCAAACGCACAGGAGCGCCGCTTTTTCCATCGCGCTGCCCCATCCAAACATCTACACCGGTGGGAACACGCTGCTTAATCAAAACAAGCCCTCCAACATGTCTGTGGGAAATGACTTTGGAAACCCTTTAAGGAAATTCAAACTCGTCTTTCTTGGAGAG[C/T]AAAGCGGTGAGTGTCATATTGGAATTTCCTAAGGAAGTTTTGATGATAAGCTTTATCGCTGATTATATGCAAGGGTCTGTATACACCTGCTTGACTTGAACGTTAAGAACATAATGATGACATTTTATCAAACATCTTATTTAAAGACCACTGAATCTACTGTGGCGTGCTGTTTTGATCTTATTTTGTGATATTTGGATTTACATGATCAATTTAATTAAGGAATAAAAAAAAAGTAATCACTCTCACCAGGATTATTGTGCTCTTTCGTATTTATTTCTGCTGTTTATTGCTGGATTGATAAATGGGTCACTTTTATAAGATTTATCAAGTATTGGCTCCAGTTTAAAGTCTTTAAGCTATAAGCTCATTTTGATTTCATTATATTGCCTTATTGTTATGTTAAAATGTAAAAATATAAAGTATTAATTGTAGATAATTGAATTTTATGAATTTAATCATGTGATGGACTATGCACTGCAGTCAAATATTTAAAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2309
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049177 Nonsense 22 208 1 8
ENSDART00000127126 Nonsense 72 258 1 8
ENSDART00000049177 Nonsense 22 208 1 8
ENSDART00000127126 Nonsense 72 258 1 8
Genomic Location (Zv9):
Chromosome 6 (position 27375757)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27676968
GRCz11 6 27667529
KASP Assay ID:
554-3060.1 (used for ordering genotyping assays)
KASP Sequence:
ATGACTTTGGAAACCCTTTAAGGAAATTCAAACTCGTCTTTCTTGGAGAG[C/T]AAAGCGGTGAGTGTCATAWTGGAATTTCCTAAGGAAGTTTTGATGATAAG
Long Flanking Sequence:
AAGTGAACTACCCCTGACTGGGATGCAGACTTTATAGTACAGTACTCTAGGTTTTAACCATGCACTATTCAACCCCAAGCACCATTCAATCAATTTTAAAAGCCATAAATAAATGTATAATAGAAAACAGTATGTTATAAAAAGCACAAACCTTCCGTAGCTTAATGTGGGCAATAATATGACATCATGTTCTGTGGGCTGATACAGCATGACGTCAGGCTCTGTGGGTTGATACAGCACTACGTCGTGTGTGTGCATGAGAGTGAGAGAGCGAGGTGAGGCCGCGCATGCGCAAACAGCCCTTCAGTCTGACAGCCGATCCAGTGCAGCATTCCCGTCTCCAAACGCACAGGAGCGCCGCTTTTTCCATCGCGCTGCCCCATCCAAACATCTACACCGGTGGGAACACGCTGCTTAATCAAAACAAGCCCTCCAACATGTCTGTGGGAAATGACTTTGGAAACCCTTTAAGGAAATTCAAACTCGTCTTTCTTGGAGAG[C/T]AAAGCGGTGAGTGTCATATTGGAATTTCCTAAGGAAGTTTTGATGATAAGCTTTATCGCTGATTATATGCAAGGGTCTGTATACACCTGCTTGACTTGAACGTTAAGAACATAATGATGACATTTTATCAAACATCTTATTTAAAGACCACTGAATCTACTGTGGCGTGCTGTTTTGATCTTATTTTGTGATATTTGGATTTACATGATCAATTTAATTAAGGAATAAAAAAAAAGTAATCACTCTCACCAGGATTATTGTGCTCTTTCGTATTTATTTCTGCTGTTTATTGCTGGATTGATAAATGGGTCACTTTTATAAGATTTATCAAGTATTGGCTCCAGTTTAAAGTCTTTAAGCTATAAGCTCATTTTGATTTCATTATATTGCCTTATTGTTATGTTAAAATGTAAAAATATAAAGTATTAATTGTAGATAATTGAATTTTATGAATTTAATCATGTGATGGACTATGCACTGCAGTCAAATATTTAAAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14349
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049177 Nonsense 42 208 2 8
ENSDART00000127126 Nonsense 92 258 2 8
Genomic Location (Zv9):
Chromosome 6 (position 27483689)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27784900
GRCz11 6 27775461
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGACWTCCCTGATCACACGCTTCATGTATGACAGCTTTGACAACACATA[T/A]CAGGTAGGCTGCTTGACGTCCTTGTCATTCCATCATTCGTAGAGCTCAAA
Long Flanking Sequence:
TTCACTGCAAGGTTAAGCTTTACAAGGAATTGCTCACAAATATAGCATTTTAACCAACAGAAGGCCTTTATATTGTATTATTATTGCTTTTTTTTACCATGTGTAACAACACTAATATAATAATATTATACTTACAATATAGAGATAATATTGTATTGTTAGTACATTATCAAGATACATATTGAATTGTGACTGTAGTGTATATATATATATGGTTTATAGATTAAATGCTAAATGGCTTGCTGTATACTGACGACCTTCTCGATTAGTCTTCTATTGAATGATTAGATCTCTTGGCAGAGGTTTCAATTAGCGCAGTTGGCAGCCCACGGCTTGCAAATCAATCCAGTAAGCCCAGGCAGGCATCACTGGCTTCCTCAGTCGCCGTCTGCTTTCAAATGGCTTCTGTTTTAATGCTTTTTTTCTCCTCTTTGTTCTCTTACAGTGGGGAAGACTTCCCTGATCACACGCTTCATGTATGACAGCTTTGACAACACATA[T/A]CAGGTAGGCTGCTTGACGTCCTTGTCATTCCATCATTCGTAGAGCTCAAAGTTGCCCTCCTCTTATTGTGCACCATCAAAAGAGTCCTTTCACACAATCTTCTGAAAACACAATGAGCTGAGTTTGTTCATTTGTGAGGATAATTTTAACAAATTGATTATAAATGTGCAGCATTATTGGGGTGTTGTGCGGTTGTTGATTCACACAGATGCATTTGTGAAGTTTAAATATCCTTAGTTGACAAATTGGCTTTTTGTTTGTAAAACACCATTTTTGGATAAAATTTCTAAATATATATTTTTTTTAATTTTAAAGTTCAAATATTGAAAGTATAAGAGCATAAAACATAAAAACATAACAAAATATAACACCAACTGTATCAATTTCTTTACAGTTTTTTTTTTTACTGAAAAGTACAAAAAAACTGTCCAATAGTGTGACAGCAAAACATATAGATATAGCGTTTATTTTATTCCTTGTTTTTAAGTTTAAGTTTAAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2338
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049177 Nonsense 168 208 7 8
ENSDART00000127126 Nonsense 218 258 7 8
Genomic Location (Zv9):
Chromosome 6 (position 27570313)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27871524
GRCz11 6 27862085
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAAAGCCATGCTCTCTAACAGTGTTGTCTCTTCATTCCCACAGCTGTTT[C/T]KAYGTGTGGCAGCTGCCCTTCCAGGAATGGAGAGCATGCAGGAGACAAGC
Long Flanking Sequence:
AAACATGTATTACACAAGGTGATGAAAACCTACCTATTGTCAAACAAGTGCACATTTTTCAACATTTTGGTGTTTTGTATAAATTACAGTGAACACAATACAGCATATATAGTGTATTACAGTACATCTTAAGTGCACATGTATATTCAGGAAGAAACAAAAAGTTTTTAGAATTATTAAAGAGAACTTGTTTGATTCATTAGAAAATTTGTTATTCTTCCACCTTCAATTTCAATACTAAGGAACTTTCTGTTGTTCTTCACAGTGAATTACGTAGCCAACTAATATTTTCGTTTAGATTTTTTTTTTTCGTCAGTTTTTTTATTTCATAAACTTATAAAATTCCTTTTTTGCCTTTATTGGAATGACTGGATTCCCTATCAAGCATACCTTGCCAAACAATGACTTAGTGTTTCAGTATAAAATGTTCAGGTTACTGACAGGGTACTGACAAAGCCATGCTCTCTAACAGTGTTGTCTCTTCATTCCCACAGCTGTTT[C/T]GACGTGTGGCAGCTGCCCTTCCAGGAATGGAGAGCATGCAGGAGACAAGCAAAGAAGGCAGTATCCTTTTAAAAACCAAAACAATTTCCCAAATCAGATCCAATGTAAAAGTGCAATGTGCTCTCGAGTTACTCTGCTTCAATCTGCTTTACATTCAACAGGATATAAATCAGCAAGAACTGACCTTAATCTTTTCCCTATGGCCGCAACTATTTTTGTCTAATGAACTCAAGTACCACTTCACCGAGACCAGAAACATATACAGTTAAAGTTAGAATTATTAGCCCCCCTGAATTATTAGGCCCCCAGTTTATTTTTTTCCCCCCAACTTCTGTTTAACGAAGAGAAGATTTTTTTTAACATATTTCAGAACATAATAGTTTTAATAACTCATTTCTAATAGCTGATCTATTTTATCTTTGCCATGATGACAGTAAATAATATTTGACTAAATATTTTTCAAGACACTTCTATACAGCTTAAAGTTAGGTTAGGCATGT
Associated Phenotype:
Not determined