Busch Lab

ZMP

aldoab

Ensembl ID:
ENSDARG00000034470
ZFIN ID:
ZDB-GENE-040426-2299
Description:
aldolase a, fructose-bisphosphate, b [Source:RefSeq peptide;Acc:NP_998380]
Human Orthologue:
ALDOA
Human Description:
aldolase A, fructose-bisphosphate [Source:HGNC Symbol;Acc:414]
Mouse Orthologues:
Aldoa, Aldoart1, Aldoart2
Mouse Descriptions:
aldolase 1 A retrogene 1 Gene [Source:MGI Symbol;Acc:MGI:2447811]
aldolase 1 A retrogene 2 Gene [Source:MGI Symbol;Acc:MGI:1931052]
aldolase A, fructose-bisphosphate Gene [Source:MGI Symbol;Acc:MGI:87994]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa22002 Essential Splice Site Available for shipment Available now
sa22001 Nonsense Available for shipment Available now
sa19021 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4446
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042200 Essential Splice Site 181 364 5 7
ENSDART00000042200 Essential Splice Site 181 364 5 7
Genomic Location (Zv9):
Chromosome 12 (position 4738451)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4021173
GRCz11 12 4057938
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCACAGTGTGTCAGATGAATYATTTATATTCATTTCTGTTGCTGTGGTC[A/T]GCATGGTATTGTACCCATCGTGGAGCCTGAGATCCTGCCTGATGGTGATC
Long Flanking Sequence:
CGGAAAAGCGCAATATAAAAATGTAAGGAATTATTATTATTATTATTTTACTGTCTTTTCTTTATTACAAGTACGCACTGTTTTAAATACGTTTTAGTTTGAAGTTGTGAAAGTCATTCTTGATGTGCAGCTGATCACAGAGGGTTGGAACAGATCTTTTAATCCTAGTTTCTTTGCAAATCCTGTTCTGTGGATATGTTCATATGCGTTACTATGGAGACATGTTATCACGTGCCTGTCAATCAATTCGGTGGGCGGGGAAAACTGCACTCCTACATCACTTTGCGGTGAGCCTCAAAATCTCTAGGATTAGGATCCTATTTGGTCAGAAAATTGACTTATTGTGTTTATATCACACCAATATGACAGTGGACACACTATACCTACACACAGTCCTGTCTAAACAGCTTCCTAAAGTTGTTTTTCACATCATAGGTGGCCTTTAACATATGCACAGTGTGTCAGATGAATCATTTATATTCATTTCTGTTGCTGTGGTC[A/T]GCATGGTATTGTACCCATCGTGGAGCCTGAGATCCTGCCTGATGGTGATCATGACCTGAAGAGATGCCAGTACGTGACGGAGAAGGTTCTGGCAGCGGTGTACAAGGCTCTTTCAGACCATCATGTGTATCTGGAGGGAACCCTGCTGAAGCCCAACATGGTGACGGCCGGTCACTCCTGCTCCCATAAATACTCACCTCAGGAGATCGCCATGGCTACTGTCACAGCCCTGCGCCGCACCGTTCCACCTGCTGTCCCCGGTGAGCCCAAAAACACCCACAGTCACGCTTAAAGGGATAGTTCACCCAAAAATCCACCTTCTGTCATCATTTATTCACACTTATAAACTCGTTTCAAACCTTTATGAGTTTCTTTCTTTTGTTAAACACTAAATAAGATACTTTGAAGAATGCTGGGGGAAGCCATTGATTTCAATAGTATTTGTTTTTTCGACTATGGAAGTCAGTGGTTACAGGTTTTCAGCTTTCTTCAAAATATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22002
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042200 Essential Splice Site 181 364 5 7
ENSDART00000042200 Essential Splice Site 181 364 5 7
Genomic Location (Zv9):
Chromosome 12 (position 4738451)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4021173
GRCz11 12 4057938
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCACAGTGTGTCAGATGAATCATTTATATTCATTTCTGTTGCTGTGGTC[A/G]GCATGGTATTGTACCCATCGTGGAGCCTGAGATCCTGCCTGATGGTGATC
Long Flanking Sequence:
CGGAAAAGCGCAATATAAAAATGTAAGGAATTATTATTATTATTATTTTACTGTCTTTTCTTTATTACAAGTACGCACTGTTTTAAATACGTTTTAGTTTGAAGTTGTGAAAGTCATTCTTGATGTGCAGCTGATCACAGAGGGTTGGAACAGATCTTTTAATCCTAGTTTCTTTGCAAATCCTGTTCTGTGGATATGTTCATATGCGTTACTATGGAGACATGTTATCACGTGCCTGTCAATCAATTCGGTGGGCGGGGAAAACTGCACTCCTACATCACTTTGCGGTGAGCCTCAAAATCTCTAGGATTAGGATCCTATTTGGTCAGAAAATTGACTTATTGTGTTTATATCACACCAATATGACAGTGGACACACTATACCTACACACAGTCCTGTCTAAACAGCTTCCTAAAGTTGTTTTTCACATCATAGGTGGCCTTTAACATATGCACAGTGTGTCAGATGAATCATTTATATTCATTTCTGTTGCTGTGGTC[A/G]GCATGGTATTGTACCCATCGTGGAGCCTGAGATCCTGCCTGATGGTGATCATGACCTGAAGAGATGCCAGTACGTGACGGAGAAGGTTCTGGCAGCGGTGTACAAGGCTCTTTCAGACCATCATGTGTATCTGGAGGGAACCCTGCTGAAGCCCAACATGGTGACGGCCGGTCACTCCTGCTCCCATAAATACTCACCTCAGGAGATCGCCATGGCTACTGTCACAGCCCTGCGCCGCACCGTTCCACCTGCTGTCCCCGGTGAGCCCAAAAACACCCACAGTCACGCTTAAAGGGATAGTTCACCCAAAAATCCACCTTCTGTCATCATTTATTCACACTTATAAACTCGTTTCAAACCTTTATGAGTTTCTTTCTTTTGTTAAACACTAAATAAGATACTTTGAAGAATGCTGGGGGAAGCCATTGATTTCAATAGTATTTGTTTTTTCGACTATGGAAGTCAGTGGTTACAGGTTTTCAGCTTTCTTCAAAATATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22001
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042200 Nonsense 223 364 5 7
Genomic Location (Zv9):
Chromosome 12 (position 4738321)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4021043
GRCz11 12 4057808
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAAGGTTCTGGCAGCGGTGTACAAGGCTCTTTCAGACCATCATGTGTA[T/G]CTGGAGGGAACCCTGCTGAAGCCCAACATGGTGACGGCCGGTCACTCCTG
Long Flanking Sequence:
CTGATCACAGAGGGTTGGAACAGATCTTTTAATCCTAGTTTCTTTGCAAATCCTGTTCTGTGGATATGTTCATATGCGTTACTATGGAGACATGTTATCACGTGCCTGTCAATCAATTCGGTGGGCGGGGAAAACTGCACTCCTACATCACTTTGCGGTGAGCCTCAAAATCTCTAGGATTAGGATCCTATTTGGTCAGAAAATTGACTTATTGTGTTTATATCACACCAATATGACAGTGGACACACTATACCTACACACAGTCCTGTCTAAACAGCTTCCTAAAGTTGTTTTTCACATCATAGGTGGCCTTTAACATATGCACAGTGTGTCAGATGAATCATTTATATTCATTTCTGTTGCTGTGGTCAGCATGGTATTGTACCCATCGTGGAGCCTGAGATCCTGCCTGATGGTGATCATGACCTGAAGAGATGCCAGTACGTGACGGAGAAGGTTCTGGCAGCGGTGTACAAGGCTCTTTCAGACCATCATGTGTA[T/G]CTGGAGGGAACCCTGCTGAAGCCCAACATGGTGACGGCCGGTCACTCCTGCTCCCATAAATACTCACCTCAGGAGATCGCCATGGCTACTGTCACAGCCCTGCGCCGCACCGTTCCACCTGCTGTCCCCGGTGAGCCCAAAAACACCCACAGTCACGCTTAAAGGGATAGTTCACCCAAAAATCCACCTTCTGTCATCATTTATTCACACTTATAAACTCGTTTCAAACCTTTATGAGTTTCTTTCTTTTGTTAAACACTAAATAAGATACTTTGAAGAATGCTGGGGGAAGCCATTGATTTCAATAGTATTTGTTTTTTCGACTATGGAAGTCAGTGGTTACAGGTTTTCAGCTTTCTTCAAAATATTGTATTATTACGTATAAGTCAAGTCTCGCTTTCAGTTTCAGGCTCTGGCGCGTTTTGCACTCATACACAAGCGTACCGCGCCAAAGCCCAAGTGAACCGCTCGATTCAGCGCACTCACACTTCTCAAATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19021
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042200 Nonsense 302 364 6 7
Genomic Location (Zv9):
Chromosome 12 (position 4737620)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4020342
GRCz11 12 4057107
KASP Assay ID:
2260-4843.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCATCAACCAGTGTCCGCTGAGCAAACCCTGGGCCCTCACCTTCTCCTA[C/A]GGACGGGCCCTGCAGGCCTCCGCTCTTAAAGCCTGGGGAGGAAAGAAGGA
Long Flanking Sequence:
TTATTCACACTTATAAACTCGTTTCAAACCTTTATGAGTTTCTTTCTTTTGTTAAACACTAAATAAGATACTTTGAAGAATGCTGGGGGAAGCCATTGATTTCAATAGTATTTGTTTTTTCGACTATGGAAGTCAGTGGTTACAGGTTTTCAGCTTTCTTCAAAATATTGTATTATTACGTATAAGTCAAGTCTCGCTTTCAGTTTCAGGCTCTGGCGCGTTTTGCACTCATACACAAGCGTACCGCGCCAAAGCCCAAGTGAACCGCTCGATTCAGCGCACTCACACTTCTCAAATGATGTGGGAAACGGGCCTGGGCACAGTTCGCATAGCATAGTGTGAGAGAATCGTCCTAACTCCCCTTAATATTATCATCATCATCATCTTCCCAAAGGCATCACCTTCCTTTCTGGAGGCCAGAGCGAGGAGGAAGCTTCAATCAACCTGAGCACCATCAACCAGTGTCCGCTGAGCAAACCCTGGGCCCTCACCTTCTCCTA[C/A]GGACGGGCCCTGCAGGCCTCCGCTCTTAAAGCCTGGGGAGGAAAGAAGGAGAATGGCAAGGCCTGCCAGGAGGAATTCGTCAAGAGAGCCGTGGTATGTGAACTTGCATGAATTATTAGCCCTCCTGTACATTTCCTCCCCAATTTAGGCAAGTTAAGGTAATTAGGCAAGTCATTGTATAATGATGGTTTGTTCTGTAGATAATTGAAAATAAATACTGCTTAAGGGGGTTAATAATATTGACCTTAAATTGTTTTTTTTTTAAATAAAACTGCTTTTATTCTAGCTGAAATAAAACAAATAAGACTGTCTCCAGAAGAAAAAAATACTATAGGAAATACTGTGAAAAATTCCTTACTCTGTTGAACAATGATAATACATTTTTTTTAAATCACAGGATGGCATTTTGACTTCAATTAAGTATTTATACCCAATTAAAAGAGTACTATAGTAATTACAGCGAATACTATAGAATACTATAGAAAAGTAAAATAAAATGT
Associated Phenotype:
Not determined