Busch Lab

ZMP

igf1rb

Ensembl ID:
ENSDARG00000034434
ZFIN ID:
ZDB-GENE-020503-2
Description:
insulin-like growth factor 1b receptor [Source:RefSeq peptide;Acc:NP_694501]
Human Orthologue:
IGF1R
Human Description:
insulin-like growth factor 1 receptor [Source:HGNC Symbol;Acc:5465]
Mouse Orthologue:
Igf1r
Mouse Description:
insulin-like growth factor I receptor Gene [Source:MGI Symbol;Acc:MGI:96433]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa20878 Nonsense Available for shipment Available now
sa38598 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31553 Nonsense Available for shipment Available now
sa11056 Nonsense Available for shipment Available now
sa2385 Nonsense F2 line generated Not yet available
sa5760 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa20878
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046542 Nonsense 477 1380 7 21
Genomic Location (Zv9):
Chromosome 7 (position 16325861)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15308740
GRCz11 7 15557027
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAATGTTTCATTTTGTACTTTCTGTTTTTCTTAGGTGGGACTAAAATCT[T/A]AAAGTTTACTTCGAATAACACGAGGAGTAATCAAATCAAGCTGATGTGGG
Long Flanking Sequence:
TAATAAAAGTGCAGATATGAATATCAATCAATGACTAATGAAGTTTTGGATGAAAACAACACTACTTTAGGGGATTCAATCCAGCAATTAAATGCATTTACACTCTCCAAACTGTCTGTCTGCTGGTGAAGCATATTTAACAGTTGAATCTGTTTGTTGCTCTTATTCTGTGTTCTTCAGCACGTATGCCTTCGCTGCTTTGGATAACCAGCATCTGCAGCTTCTGTGGGACTGGTCACAGCACAACCTGACCATAAGTGAAGGAAAACTGTACTTCCGGTTGAACCCCAAACTCTGCATGTCCGAGATCCGCAAAATGTGGGCCAAGACAGGAATTAAGGACAACTTTGTGGAAAGAGATTTCCGCAACAACGGGGACCGTGCAAGCTGTACATGTTATTTATTATCACTTGATTGATTTATTCAGGAATGTAAACTTTAGTGTGCATTTAAATGTTTCATTTTGTACTTTCTGTTTTTCTTAGGTGGGACTAAAATCT[T/A]AAAGTTTACTTCGAATAACACGAGGAGTAATCAAATCAAGCTGATGTGGGAAAGTTATCGACCGTCTGATTCCAGAGATCTTGTCAATTTTATTGTGTACTACAAAGAAGCGTAAGTTTGGGTTTTGTTTAGAAGCTTTTTCTCAAGCAAGGTTATTATAGTTTTGCATTTTTAGATGCTTTTTAACAAAAAAGGCTCTAACTTTTAGTTTAGTTTTAGTTAGTTTCATCAATGGCTAGTTTAAATTTTTGTTAGCAAATGAATTTGTAAAAGCGCCTACCCCACTGCCCCCACCCCCCAAAAAATGTAAAATTTATTTATATAGCACATTGTGATTTTTATAAATCCCAAAGTGCTTTACAAAGAAGATGCAAGCAAGCAGTATGGACATAAAACAAAACAGCAATAGGCATAAAAGATGTAAAATCGGTCATACGAAAAAACTGTTTATTTTCAATGCCTAAAAAAAGAAATTCATTGATCCTTTAGTTAATTCCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38598
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046542 Essential Splice Site 723 1380 10 21
Genomic Location (Zv9):
Chromosome 7 (position 16331857)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15314736
GRCz11 7 15563023
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACCGCAAAGCCTTCGAGAACTTCCTCCACAATGCCATTTTCACTCCCAG[G/A]TAAACCCTAGTTTGATCAGGAATGTGATTATTACTATTACTATATCTAAA
Long Flanking Sequence:
TTTCCGACAGCAATTAAGACTTTTTAGCATGAAACATCTGAAGCTTTCAGTGTCAGTGCATCTAGGGAAATTAGATCAAACACTGTTTGAAAACTCTTTTAGTTCTCGACTTCAAAATACACCAGGCTTTGCAATAATGAAATGATGTGCAACATGTTTAACATTGTCTGTATGTTATTAGTGCCGCTCTGTATTACTCATACTTGATTTTCTGTGGCACTGGTAAATAATTCCAGATTGTCGCAAGATCACAACAGGAAGAAAATATAACAATGTTTGTGTAAATCTCTGACAGAACTGAAGATCCCTGTAAGGGTTTCAGCCACGGGTTTGACAGACACTGAAGACACGAAGCCGACCAATCATGAAACAGGAGGACGAGACAAAACCCCCTGCTGTCCCTGCCCTAAAACAGAGGAGGATCTGAAGCGAATCGAGGATGACATCTACTACCGCAAAGCCTTCGAGAACTTCCTCCACAATGCCATTTTCACTCCCAG[G/A]TAAACCCTAGTTTGATCAGGAATGTGATTATTACTATTACTATATCTAAAAACCCAACTGATAGTGTTTTCAAAAGCACACCTTGTCATCACAGCAACAGAATTTCACCATGTTTAAGATTTTTATATATTTTTGGCTTTTGTTTCACCTGGTTTTTGGAGTCGTTTGTCGACAGAATTGAACTCTGTCTTCATGGTCAACTCCGCTCCATGTCCCAAGTTGGCCGACGTACATGGCGAGCCACTGGGGAATCTGGTAACACCGAAAAATTCGTAAATACTGAAGTAAGCTGGTAGAGCTACAATAAGCAGAGGCTGGCGGTGGCGTCACACTTCCCTGTAGCGTTCGTTTTAAAAATGAAATGCAGCCAGACGTACCTCTGGCTACATAATTTGTGCTCTCCAGAAATGTAGACAGGGTACCTTTCCACTATGAGCCTGTGTTGAAAATATATTACTCATATTTACTGAGAAATGGATAAAAATATTCAGTTTCAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31553
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046542 Nonsense 728 1380 11 21
Genomic Location (Zv9):
Chromosome 7 (position 16341434)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15324313
GRCz11 7 15572600
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATTTCCCTAATAGATCTTAATCTCTCTGGTTTCAGACCTCCAGACAGG[C/T]GACGGAGGGATTTGTTTGGTGTGGCCAACGTAACCTCTATTCACACTCTG
Long Flanking Sequence:
ACAATAAATGTGCAGCAATTTAAAAAAAAAAATCTTTTTTCACATTGTCATTATAGAGCATTGTGTGTAGAATTTTGTGGAAATAAGTTCTGATTTCTGATTTCAACTGTACATTTCAGTAGTTTCTCCTTGCGTCATTTGATTGTTATTACACATGACTCATTTTTCTGATTTTTCGTTTTGTTTTTGTTTTTATGTTTGTAATGTATTATTTTTATTTACCAAAATCTGGTTCAATTCCATGTCAACAGCTCCTTTTGAAATATTGTTCTCAGGGAAAAAATATGCCATGCTTAATACTTATTTTTTGTCACTGTAATTTTATGCTCAAAAATAAATTTCTGTTAACTAAAATCAGTTGTACTCCTATTCTGATTCATTCATTCAACTTTTTAATAAATGAGAATTCTTGTTGCCAGATTGAGCTTTTGTCATGCCTGAAGTTGTGCAATATTTCCCTAATAGATCTTAATCTCTCTGGTTTCAGACCTCCAGACAGG[C/T]GACGGAGGGATTTGTTTGGTGTGGCCAACGTAACCTCTATTCACACTCTGCTAGCGGGACACTGGAACCTGACCGAGGGAAACTTCTCAGATGACGAGCCGCCTAGACGAGAATTTTCCTTTCTGGAGAGGAAGGTGAAAGAGCGACACATTGAAATCACTGGCCTGCAGCCTTTTACCGTTTACCGCATTGACCTACACGCGTGCAATGAAGAGGTTCGACACTGCAGTGCCGCTGCATTCGTCTTCTCTCGCACCAAAGCAGCAGGTAAGAGCGGGACATCAAAACTTAAATAAGACTATAAAGAGGATAATTTTTAATTACAACAAATGAAAACATTTGGCATTCTATTAAAAATAAATGGTCATGAAATTTGAAAACAATAGAATTAATACTAACATTTCACTCAAATCAACAGCTAAAATTTTCCACGGGAAATTTTGAAGTTGTTTCATTGCACTGGGATTTACTTTACAATTAACACTATTTAAATAGTATAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3628
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046542 Essential Splice Site 916 1380 13 21
Genomic Location (Zv9):
Chromosome 7 (position 16349869)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15332748
GRCz11 7 15581035
KASP Assay ID:
2259-8542.1 (used for ordering genotyping assays)
KASP Sequence:
AAACGGATCCTGGACAGAGCCCATAGCTTTCTCCGTGCATCAGCTGGAAC[G/A]TAGGTTTACCGCCACCTTCAAAACATTGCAATTTGTAATCACGTTATTGA
Long Flanking Sequence:
TACCACAGGTAAACTCCAATAAAGCTGCTGAAACTTCTCAAAAATGATCAGTGAAAACAGAATGTATTTGAGCGCAATTTAGAGCTTCACGGCAATTTACATGCGATTTTTCAGGTTTTTTATTGTGAATAAATTTGCAAAAATTTCAGAAAATAATTTTTCACCTTGTCATTATGGGTTGTTGTGTAGAATTTTGAGTAAATAAATGAATTTAATCAATTTTGGAATAAAGCTGTAACATTAAAAATGTGGAAAAAGTGAAGCGCTATGAATACTTTCTGGATGCGCTGTATGTTGACCAGCTTGTTTTTCTGTTGATGCTTTTTTTCTTCAGCCTGAGAAGCACGAGTGTGTTTCCCGTCAACATTACAGGAAGCACAAAGGAGTGAAACTCTCAAACTTGGGACCAGGGAACTATTCTGTCCGTGTTCGGGCCACGTCTCTCGCTGGAAACGGATCCTGGACAGAGCCCATAGCTTTCTCCGTGCATCAGCTGGAAC[G/A]TAGGTTTACCGCCACCTTCAAAACATTGCAATTTGTAATCACGTTATTGAGTTATTCACACTTGTCTGTTTTGCATTTTCAAGAATCCAGTTATGATCCTGTAATGTTTATCGCCATCCTCCCGGCCTTACTGTTAATCGCTGGTCTGGTAGTATTTGGGTACACCTGGATGAACAAGAACCGGTACCAGTTTTATCACTTCTACACTCTCCATATTCTTGTAATTAATTTTTTACAGCATTGTCCCCTCTGGACAAAGCGAATCTATCAGAGACGCTCCAGACGCTGCAATATTAAACGGCAAAGCAATTATCTTGAAATGTTTCCAGCTTGTTCTCTATTAAACGTTTTACTGCTGTTTTTTTCGTAAACAAGTGTTGTCTGGAATCCACAGAAACAATGACAGGCTTGGAAATGGAGTACTTTACGCCTCCGTTAACCCAGAGTACTTCAGTGCAGCAGAGAGTGAGTATGCTGAATCTTATTTTACACATTTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11056
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046542 Nonsense 995 1380 16 21
Genomic Location (Zv9):
Chromosome 7 (position 16351351)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15334230
GRCz11 7 15582517
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGAATGGGAAGTGGAGCGGGAGAAGATCACGATGTGCCGAGAGCTTGGA[C/T]AGGGGTCRTTTGGTATGGTGTATGAGGGCATCGCCAAAGGTGTCGTTAAA
Long Flanking Sequence:
AAACAAAAAATATATATACATGTATATATTCTTTTTTTTTTTTTTTGGTGGGGTGAGAGGCATTTGAAGTAGGTTCCTGCCCCAATAGAGCTTTATGTCTAGCAGCGCCCCTGTTACTACCTGCATATTGTTTGTAAATTAAATATTTATTAGCAATAAGTATTATTTATTTTTAATAAGCAGCTAATTTGTGGTTTATTGTGCTAAAAGTCCTAGTTAATGGTTTGTTAATAGCATGAACATTAAAAAAGTGTGACTAAACTTAACATAAATACTATACATGAAATTGCGCAAAATTGTATTTTGTACAATGAATTATGCTGAAGAGAGATTTTGAGGTAAAATGATATGTAGGGTTTGTTGAAAGTGACTAGTGTAGATATAGTGGGATAAGTATTGCTGATTAGTGACTATCTACGTGATAATGTATGTTTGCAGTGTATGTGCCGGATGAATGGGAAGTGGAGCGGGAGAAGATCACGATGTGCCGAGAGCTTGGA[C/T]AGGGGTCGTTTGGTATGGTGTATGAGGGCATCGCCAAAGGTGTCGTTAAAGATGAGCCGGAAACCAGGGTGGCCATTAAAACGGTCAACGAATCGGCCAGTTTACATGAGCGCATTGAGTTCCTTAATGAAGCCTCCGTGATGAAAGAGTTCAACTGTCACCATGTGGTGAGTTAAAGAAATCTCATCTCACTAGCTTAGTTAGACTCTTTTTCCCTTGTAAAAGTTTGACATGCATTACTCAACATTCGACGTGGATCTAAACCTTTCCTCAGAGTTGTCCTGAAACATTTAAACGTCTATTCTTCAATTTTTAAACACTTTCTACTCTTTACTTCAAGTTGAAGTTTTGATCCACTACAAATGTTGACTACTATATGCAATCTCTGATATTTAACATTTATAAATGAACCAATGAGCTTTCTAAATATTGCCAAATTTGGATTGCAGTAGCCTTACAACAAGAATAAACCATTAACATTGTAATGTTGACTTTTAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2385
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046542 Nonsense 1357 1380 21 21
ENSDART00000046542 Nonsense 1357 1380 21 21
Genomic Location (Zv9):
Chromosome 7 (position 16371607)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15354486
GRCz11 7 15602773
KASP Assay ID:
554-3392.1 (used for ordering genotyping assays)
KASP Sequence:
CAGCGGCCAACGGGCCCTCCATGGTCCTGAGGGGGCCKTTTGAGGAGGGT[C/T]AGCCTTACGCTCATATGAACGGGGGCCGGAAGAACGAGCGTGCCTTGCCT
Long Flanking Sequence:
TATACTTATATATTACAATTAAATCATGATAAATAATTAGCCTGATCATCTCAAATTCTTGTGTGTTTTTCTCTGAATGCCGTGTTGATCATCTCCTCTGTGTCTGATCCTCCAGGTTCGAGCTGATGCGCATGTGCTGGCAGTATAACCCCAAAATGCGGCCGTCCTTCCTGGAGATCATCAGCAGCATCAAGGAGGACCTGGAGGCAGGCTTCAAGGAGACCAGCTTTTTCTACAGCGAGGAGAACAAGCCCCCAGACACGGAGGAGCTGGACATGGAGAACGTGGGAACCATGGAGAACGTCCCTCTAGAACCGTCTTCCAGCCTGCAGCCCCTTGCGCCCTCAATATCCCCCCCTCAGCAGTGCACAGCTGCGGCCCAGAGCTGCTCGTCCCCGTCCTCGCCTCCTTCATCACCCAGCTCCACGGACAAACACCCGCTTCCGACATCAGCGGCCAACGGGCCCTCCATGGTCCTGAGGGGGCCTTTTGAGGAGGGT[C/T]AGCCTTACGCTCATATGAACGGGGGCCGGAAGAACGAGCGTGCCTTGCCTCTGCCCCAGTCTTCGGCTTGCTGATCGCCGGATGCGTCGGATGTGTGTCAAGCCACTGTGTGGTGTCCTGAGAAGAAATATTCAAGATATTCGTTTAGAGACGAAAAAAGAGAGAGTCCAGGCAATCAATTTTTTCAATCATACCTCAACGGACAAAGTTTGGAGTTCTTTGTTTTTTGTGCGTTCCGATTGAATTGTTGAATTGATGATTGAACTCATTTGTTATTTCCGCCAGACTGGATCACTGACTGAAAAAAAATATATATATATGAAAAGAAAAAAAAACATCACTTTCGCACTCAATAGGCTGTTTTTGTTACTTTTCTAAACTTCCAGAGCTGGTCTATGAGAGCCAGTAGTGGTACGGTGGCATTATTACAACATGCTCTGCATATCTCCAACTTGCGAGTTAATTGTCTTTGTTTCCAAAGACGTGCGTCTAAAAGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5760
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046542 Nonsense 1357 1380 21 21
ENSDART00000046542 Nonsense 1357 1380 21 21
Genomic Location (Zv9):
Chromosome 7 (position 16371607)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15354486
GRCz11 7 15602773
KASP Assay ID:
554-3392.1 (used for ordering genotyping assays)
KASP Sequence:
CAGCGGCCAACGGGCCCTCCATGGTCCTGAGGGGGCCKTTTGAGGAGGGT[C/T]AGCCTTACGCTCATATGAACGGGGGCCGGAAGAACGAGCGTGCCTTGCCT
Long Flanking Sequence:
TATACTTATATATTACAATTAAATCATGATAAATAATTAGCCTGATCATCTCAAATTCTTGTGTGTTTTTCTCTGAATGCCGTGTTGATCATCTCCTCTGTGTCTGATCCTCCAGGTTCGAGCTGATGCGCATGTGCTGGCAGTATAACCCCAAAATGCGGCCGTCCTTCCTGGAGATCATCAGCAGCATCAAGGAGGACCTGGAGGCAGGCTTCAAGGAGACCAGCTTTTTCTACAGCGAGGAGAACAAGCCCCCAGACACGGAGGAGCTGGACATGGAGAACGTGGGAACCATGGAGAACGTCCCTCTAGAACCGTCTTCCAGCCTGCAGCCCCTTGCGCCCTCAATATCCCCCCCTCAGCAGTGCACAGCTGCGGCCCAGAGCTGCTCGTCCCCGTCCTCGCCTCCTTCATCACCCAGCTCCACGGACAAACACCCGCTTCCGACATCAGCGGCCAACGGGCCCTCCATGGTCCTGAGGGGGCCTTTTGAGGAGGGT[C/T]AGCCTTACGCTCATATGAACGGGGGCCGGAAGAACGAGCGTGCCTTGCCTCTGCCCCAGTCTTCGGCTTGCTGATCGCCGGATGCGTCGGATGTGTGTCAAGCCACTGTGTGGTGTCCTGAGAAGAAATATTCAAGATATTCGTTTAGAGACGAAAAAAGAGAGAGTCCAGGCAATCAATTTTTTCAATCATACCTCAACGGACAAAGTTTGGAGTTCTTTGTTTTTTGTGCGTTCCGATTGAATTGTTGAATTGATGATTGAACTCATTTGTTATTTCCGCCAGACTGGATCACTGACTGAAAAAAAATATATATATATGAAAAGAAAAAAAAACATCACTTTCGCACTCAATAGGCTGTTTTTGTTACTTTTCTAAACTTCCAGAGCTGGTCTATGAGAGCCAGTAGTGGTACGGTGGCATTATTACAACATGCTCTGCATATCTCCAACTTGCGAGTTAATTGTCTTTGTTTCCAAAGACGTGCGTCTAAAAGAAAT
Associated Phenotype:
Not determined