Busch Lab

ZMP

atp1b2b

Ensembl ID:
ENSDARG00000034424
ZFIN ID:
ZDB-GENE-010718-1
Description:
ATPase, Na+/K+ transporting, beta 2b polypeptide [Source:RefSeq peptide;Acc:NP_571913]
Human Orthologue:
ATP1B2
Human Description:
ATPase, Na+/K+ transporting, beta 2 polypeptide [Source:HGNC Symbol;Acc:805]
Mouse Orthologue:
Atp1b2
Mouse Description:
ATPase, Na+/K+ transporting, beta 2 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88109]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa13292 Nonsense Available for shipment Available now
sa12906 Nonsense Available for shipment Available now
sa20490 Nonsense Available for shipment Available now
sa12895 Essential Splice Site Available for shipment Available now
sa2197 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa13292
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097822 Nonsense 9 292 1 8

The following transcripts of ENSDARG00000034424 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 40107099)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37906489
GRCz11 5 38506642
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAGYGCACATTTAGTCCAGGAAAATGGCCAAGGATGACAAGAACGGCTG[G/A]AAGGAGTWCTTCTGGAACCCGAGGAYCCGCGAGTTCTGCGGGAGGACCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12906
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097822 Nonsense 36 292 2 8

The following transcripts of ENSDARG00000034424 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 40091397)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37890787
GRCz11 5 38490940
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTTTTTTTTTTTTTKTTTTTTTTTTKCAGGTCTGATTYTGCTGTTTTW[T/A]CTGGCATTCTACATATTCCTGGCTGGATTRTTTACTCTCACCATGTAYGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20490
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097822 Nonsense 77 292 3 8

The following transcripts of ENSDARG00000034424 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 40091023)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37890413
GRCz11 5 38490566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTCTCCTCCTCTCTTTTGTTTATTTGATGTTTTGCAGGGATGATGATC[A/T]GACCTAAAGGAGAGCAGCTGGAGATTGCTTATACCACCGAGTACACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12895
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097822 Essential Splice Site 107 292 3 8

The following transcripts of ENSDARG00000034424 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 40090929)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37890319
GRCz11 5 38490472
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACAGAGACCTGGGAAAGATACGTGCAGGCTCTCAATAACTTCCTCTCAC[G/A]TGCGTTTATTTAACAACCCTAATGCTGCATGTATTGCACAGTAAATATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2197
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097822 Nonsense 291 292 8 8

The following transcripts of ENSDARG00000034424 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 40077236)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37876626
GRCz11 5 38476779
KASP Assay ID:
554-2491.1 (used for ordering genotyping assays)
KASP Sequence:
AACGAGACAAGTTTGCTGGACGAGTTTCCTTCACACTGAGGATCAACTCC[A/T]GAGATTGAACAGACAAGAGTGTTTGTTTNTTTTTTTNGCACGCACACACAT
Associated Phenotype:
Not determined