Busch Lab

ZMP

zgc:110801

Ensembl ID:
ENSDARG00000034313
ZFIN IDs:
ZDB-GENE-050327-75, ZDB-GENE-050327-75
Description:
serine/threonine-protein phosphatase 5 [Source:RefSeq peptide;Acc:NP_001014372]
Human Orthologue:
PPP5C
Human Description:
protein phosphatase 5, catalytic subunit [Source:HGNC Symbol;Acc:9322]
Mouse Orthologue:
Ppp5c
Mouse Description:
protein phosphatase 5, catalytic subunit Gene [Source:MGI Symbol;Acc:MGI:102666]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42470 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3932
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102096 Essential Splice Site 23 481 None 14
ENSDART00000102103 Essential Splice Site 23 162 None 4
ENSDART00000129380 Essential Splice Site 23 162 None 4
Genomic Location (Zv9):
Chromosome 15 (position 2745554)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 2790618
GRCz11 15 2753901
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATGCCAGTGCWGAGAAACTCAAGGAGAAGGCTAATGACTACTTTAAAGG[T/C]ACAATCATGCCAAATACCCGCTGYAGATAAGAGACTGTACTGATGTCGRC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42470
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102096 Essential Splice Site None 481 13 14
ENSDART00000102103 None None 162 None 4
ENSDART00000129380 None None 162 None 4
Genomic Location (Zv9):
Chromosome 15 (position 2722186)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 2767340
GRCz11 15 2730912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTCACACAGAAGCTGCTGTGGTCTGAAGTCCACGCCAATCCCTCCAAA[T/A]CCATCCTCACTTTCTTCTTATCGCCGTTTCAAACAAAAAAAAAGGTTTCT
Associated Phenotype:
Not determined