Busch Lab

ZMP

sema3c

Ensembl ID:
ENSDARG00000034300
ZFIN ID:
ZDB-GENE-050513-5
Description:
Novel protein similar to vertebrate semaphorin 3C (SEMA3C) [Source:UniProtKB/TrEMBL;Acc:Q5RGH9]
Human Orthologue:
SEMA3C
Human Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C [Source:HGNC
Mouse Orthologue:
Sema3c
Mouse Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C Gene [Source:

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa30849 Nonsense Mutation detected in F1 DNA Not yet available
sa15161 Nonsense Available for shipment Available now
sa12671 Nonsense Available for shipment Available now
sa1359 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30849
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002104 Nonsense 36 757 1 17
ENSDART00000131161 None None 713 None 16
Genomic Location (Zv9):
Chromosome 4 (position 21517464)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22860799
GRCz11 4 22581774
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTTCTCCTCGGCCTCAGCGTCTCCAGCATTCATGCTCTTTCTTCTCCA[C/T]AGCCGCGAGTCTTCCTGCCATTTCAAGGTAAGAATGGTTAATGTCATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15161
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002104 Nonsense 186 757 5 17
ENSDART00000131161 Nonsense 142 713 4 16
Genomic Location (Zv9):
Chromosome 4 (position 21562341)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22905676
GRCz11 4 22626651
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAATCAGGGAAAGGGYGCTGCTCCTTCAACCCACAAGTCAACACTGTCT[C/A]GGTCATGCTCMGTGAGTCTTTTATGTCTTTATCCACAGGTGCCAATTTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18784
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002104 Nonsense 242 757 7 17
ENSDART00000131161 Nonsense 198 713 6 16
ENSDART00000002104 Nonsense 242 757 7 17
ENSDART00000131161 Nonsense 198 713 6 16
Genomic Location (Zv9):
Chromosome 4 (position 21566119)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22909454
GRCz11 4 22630429
KASP Assay ID:
2259-4935.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTGTTTTGACCAGAGCCACTGTTCATTGACGCCCAATTGATCCCTGAT[G/T]GATCAGACCCCAACGATGCTAAACTGTACTTTTTCCTGCGGGAGCGACTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2177
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002104 Nonsense 242 757 7 17
ENSDART00000131161 Nonsense 198 713 6 16
ENSDART00000002104 Nonsense 242 757 7 17
ENSDART00000131161 Nonsense 198 713 6 16
Genomic Location (Zv9):
Chromosome 4 (position 21566119)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22909454
GRCz11 4 22630429
KASP Assay ID:
2259-4935.1 (used for ordering genotyping assays)
KASP Sequence:
TTCTGTTTTGACMAGAGCCACTGTTCATTGACGCCCAATTGATCCCTGAT[G/T]GATCAGACCCCAACGATGCTAAACTGTACTTTTTCCTGCGGGAGCGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12671
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002104 Nonsense 422 757 11 17
ENSDART00000131161 Nonsense 378 713 10 16
Genomic Location (Zv9):
Chromosome 4 (position 21573411)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22916746
GRCz11 4 22637721
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATGTGGTGACGTTTGTGAGGAATCACCCTGTCATGTTTAACCCCATCTA[C/A]CCTGTGGGAAGGAAACCCCTGGTGGWGCGAACGCATGCCGACTACAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1359
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002104 Nonsense 439 757 11 17
ENSDART00000131161 Nonsense 395 713 10 16
Genomic Location (Zv9):
Chromosome 4 (position 21573462)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22916797
GRCz11 4 22637772
KASP Assay ID:
554-1272.1 (used for ordering genotyping assays)
KASP Sequence:
CCTGTGGGAAGGAAACCCCTGGTGGTGCGAACGCATGCCGACTACAAATA[C/A]ACCTCTATAGCGGTGGATCAGGTCCCAGCAGCAGACGGCCACTACCAGGT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461