Busch Lab

ZMP

odz4

Ensembl ID:
ENSDARG00000034264
ZFIN ID:
ZDB-GENE-990714-20
Description:
Teneurin-4 [Source:UniProtKB/Swiss-Prot;Acc:Q9W7R3]
Human Orthologue:
ODZ4
Human Description:
odz, odd Oz/ten-m homolog 4 (Drosophila) [Source:HGNC Symbol;Acc:29945]
Mouse Orthologue:
Odz4
Mouse Description:
odd Oz/ten-m homolog 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2447063]

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa39035 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42497 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44819 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10710 Nonsense Available for shipment Available now
sa44820 Nonsense Mutation detected in F1 DNA Not yet available
sa22594 Nonsense Available for shipment Available now
sa44821 Nonsense Mutation detected in F1 DNA Not yet available
sa12130 Nonsense Available for shipment Available now
sa42498 Nonsense Mutation detected in F1 DNA Not yet available
sa35813 Nonsense Mutation detected in F1 DNA Not yet available
sa24976 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39035
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Essential Splice Site 457 2849 7 30
ENSDART00000045312 Essential Splice Site 432 2824 6 29
ENSDART00000146828 None None 2193 None 21
Genomic Location (Zv9):
Chromosome 15 (position 10761784)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10307187
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCATCCTCATCTCTGTCACCCTGGTGTTCCTGTTGGCATACTTTATTG[G/A]TAAGTTCAGTTTTTGCCAGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCT
Long Flanking Sequence:
TCTGTAAATTAAATTTGTTATTGATTCAGAATTCCGATAAAAAATGCACCCCTCGGGGGAACAGCGTGTATTGCTGCTAGCCAGAGCTCCAATGGCAACAGCTTGGAAAAATGCTTAGCAACAGCAGTACTGACCAGTGCGGGGACACAAACCTAAGACATTGTTTTACATGATGAGAGAAAAACACTCACTGTATCACACAGTGCACTCTGTCACCTGCTTCTTTTGTGAACATGAGCAAGAGCGTTTTCTGCGTCTCTGCAGACACTTTCTTTTCAAGCCTGGCGGGACCTCGCCTTTGTACTGCACCACTTCACCTGGTTACCCTTTGACGTCCAGCACGGTGTACTCTCCTCCGCCCCGGCCCCTGCCAAGAAACACCTTCTCACGGCCTGCCTTTAGCCTGAAGAAACCCTATAAGCACTGCAACTGGAAATGTGCTGCCCTCAGTGCCATCCTCATCTCTGTCACCCTGGTGTTCCTGTTGGCATACTTTATTG[G/A]TAAGTTCAGTTTTTGCCAGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTATCTATCTATCTATCTATCTATCTATCTATTAAGTGAAGACCCATATTGATTTTTTTTTTCTAAATGGCCAGTTTCTAAGCCTCATTTGTTTTTGTTTCTTTATTTCAGGTTAAAAGCAATGACAATAAACTGTTTATTATCATAAAAGTAAAATTACTGAACCTACATACGGGAGCCTTAGAAAAATACTTGAAAATGTCAAACAACACTTTGATGTTTTTGTGTCTGAACTCTTCATGTATGCAAATGAGTAGACTTTATTTAATTATTTTCAATTTAATACCAATTTTCAATTTAATACCAATTTGCTACTTCTTTACTGTATACATTTGATTGAAATTACACAATATGCATGTTGAAATTGAACATTTTTACCATGAATATATCCAATGTTGCTGACATGGGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42497
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Essential Splice Site 584 2849 9 30
ENSDART00000045312 Essential Splice Site 559 2824 8 29
ENSDART00000146828 None None 2193 None 21
Genomic Location (Zv9):
Chromosome 15 (position 10784131)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10284840
GRCz11 15 10207235
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGGTGGGGATCTACGGGAGGAGAGGACTGCCACCGTCACACACACAGG[T/G]CAGTTTTTATTCGTTTAAAGGGATAGGTCACACAAATTTTCATTTACTCA
Long Flanking Sequence:
TCTAGACAGGTTCGCAGTTCTTAACTTAACAACCTGCTTAAGAGTCTTGCTTTATTAGTTAACTTTGAGGTTATTTGGGAAATTAGCCATATTAAAGCAAATATTGAATTGTAGTACCTGCAATGGGAACTTTTTTATGGTCAGTGGTCAGCGAGGCAATTTTTTTTCCTGATGTGATGAAAAATCAGCAAGAGTGTCGTTCACCCTTTACACTGACCCTCTCCTCGCACCATATGGTAGATTTATGAGGTGTCTGGCTGACTGATAGATCTCATTTTCCTCAGGTAAACTAGATGGCTTCTTCCCGGAGGACAGCTTCATAGACATGGGCGAGATAGACGTGGGCCGCAAAGTGGCTCAGCTGATCCCGCCTGGAATCTTTTGGAGGTCGCAGGTCTTTATTGATCACCCAATGTACCTCAAATTCAATGTGTCCCTTAGTAAAGATGCCTTGGTGGGGATCTACGGGAGGAGAGGACTGCCACCGTCACACACACAGG[T/G]CAGTTTTTATTCGTTTAAAGGGATAGGTCACACAAATTTTCATTTACTCATCCTCTACAAGTTCCAAACCTGAGTTTCTTTCATCTGTTGAACACAAAGGAAGATATGCTATTTTTCGGAATATCTTTCTCTGCATTCAACAGAAGAAAGAAATTCATAAAAGTTTGAAATCACTTGAGTATTAGTAAATGACGAGGACATTTTGATTTTGAATGGTCTGTCCATTTAATGTAAAATGTGGGTATTTCTTACTTTGAGAGTAATTAAATTAATTTAATGAAATTAGTTGGCTTAAAATGTATGGAGAAGAATGAAGATTTGGAGATTCAAGCCAGAATTAAAACCTTGTTTGTTAGACATATATTTATTGCTGGATTTAATGTTATGATTTAGACATGATTGTAAATAAATTGGGGGACTGTTCTGAGTAGAATCAAAACCACTTGTTGTACATGGAGCAAGCATGTTAAACTCCAGCCACAAACATGTTGACATGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44819
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Essential Splice Site 657 2849 10 30
ENSDART00000045312 Essential Splice Site 632 2824 9 29
ENSDART00000146828 None None 2193 None 21
Genomic Location (Zv9):
Chromosome 15 (position 10790579)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10278392
GRCz11 15 10200787
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGATGGGAAGGAGACTGAGCAGGTGTCCTTTCTAACAACTGCAATCGG[T/C]TAGTATGAAACCGCATATATTGCAGAGCTGAAAACTTTGCTTTAAATATT
Long Flanking Sequence:
GCTTTAGTTATCTTATTTATTCAGATAGCGCTATAATTTCAACTTTGTTTTTCAATGTAGAGGTGAAACACAATGATGTGAAAAATTCAATGTTATGCATATGTATATATATGTATTTTTTGCATAAACTGATGCTGTCCTTTCACACCTACCATTAGTCCTCTTTTCGCCTTCAGAGACTAGTCCCTGTTGGCTTCGATATGTAGGACTTATCAGCTCCTGCAGGCTCATGTGTCAGTCCTAATGCTTGTTTGTGGTCTGTCTGTCTCTCCTTGTCTCCAGTTTGACTTTGTGGAGCTGTTGGATGGTCGTCGGCTTCTGTCGCAAGGCTTGCCAGGTCTTGATGGTCCGCCTTTTCCAGCCCAGCAGCGGAGCCTGGTGCCTATCACCAGTCATGATACAGGATTTATACAGTACATGGACTCGGGAATCTGGCACTTGGCTGTATACAATGATGGGAAGGAGACTGAGCAGGTGTCCTTTCTAACAACTGCAATCGG[T/C]TAGTATGAAACCGCATATATTGCAGAGCTGAAAACTTTGCTTTAAATATTTGAAAAGGTGTAACTGTAAAGGGGTCATGACACCCTCTACTTTTGGTTCAGTACTACCTTAGAAATTTTTTCAAAAGATGCATCATACCAGGCGTGGAGCTCTGCAAGGAAAGGTGCAGGAGTAGGCGTGGCCAGCAGGGGAGAAGGAGAGGAGTAAACAAGTATTGTTAGTTAGCTCACAAAATGAGACACAAACCGTGAGGAGACGCATGATTTTATAGTTTACAAAGTTAAAATGCAAAGAAATAAACAGTAATTTAATGCCCTGCTACATTTCGTCACCTTAGAATTATAAGGTTCTATCTGCATTCTGAATGATTTTGAGATATTGAGCTTCAAAGTTTTTGCATTCCATATAGCAAACAATATGTGTGTAACAGTTCTCTTTCATACAATAACATGACAGAGACCCTAAGGGTTCTCTAAATGCAAATGATCAAAGTTCTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10710
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Nonsense 846 2849 14 30
ENSDART00000045312 Nonsense 821 2824 13 29
ENSDART00000146828 Nonsense 190 2193 4 21
Genomic Location (Zv9):
Chromosome 15 (position 10833891)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10235080
GRCz11 15 10157475
KASP Assay ID:
2260-8179.1 (used for ordering genotyping assays)
KASP Sequence:
TGGTGGAMATGGCATCTGTGTRGCGGGCAGCTGCCGGTGCGACGAGGGCT[G/A]GATGGGCACCGGGTGYGAGCAACGGGCTTGTCACCCTCGCYGCAGCGAAC
Long Flanking Sequence:
CATTTAATCTCATGACACATGCTGCAAATCTGATTTAAATAACCCAGTGTGTCTCCATATATAGAAAGTCGGAATTGGATTTTGTTCTTTGACTTTTCTTTCTTTCGTCCTTTTCTTTTATTCGTTTTGCCTACACCCGTCCACACAATAGAAGGGATTCCCTCCAAAAAAAAAAAAAAAGGGGGAAGAGATGCAGCAGAAAATCCCCAAACCCCGGCTTTGTAATGGTTTTATTAGATTTGTATTGTCCAGAAGGGATTGCCCCCCTATTATGAGCTGCAGGAATTTCTTTTCACTCCTCATCAGACAAGGTAGTGGAGCGTGGCCGTCCCATCACTGACAATAACTCCTGGATCTGCTTCCTCTTTTTCCCTTGTCCCAAATACTCCTGGGTAACACCTCTCTTTCTCTCTGTCCCGTGTGTCCCACAGAGCTGTGCGCAGCGGACTGTGGTGGACATGGCATCTGTGTGGCGGGCAGCTGCCGGTGCGACGAGGGCT[G/A]GATGGGCACCGGGTGCGAGCAACGGGCTTGTCACCCTCGCTGCAGCGAACACGGGACCTGCAAGGACGGAAAGTGCGAATGCAGCCCGGGATGGAATGGAGAACACTGCACTATCGGTGAGGAGGAAGTGGGATGTGCTTGTGTTTTTTTGTGTGGGACGAAGGGGCGGATGAGGAGGTGTGAGAGAAGCATGCGTAATTGAATTTGTGCAACTCGGCATAGCATGAACAGGTTTGCTCAAGGATACAAAGCTTGTCTTCATGCATTTTAATGTGGGAATGTGCTAAGGTGTCTTTTTCATCATTTCTCTCTTTTCTTATTCTCCTCTCTGTCGCTCCTTCCGATTAGTTCATTTTGAACACAAACATTTGCGCTGCACGAGAGGACTCAGTCACTGGAAAGACATTCTTTACATTGGGGAATTAAAATGGAATATTGTGAAAAAAATATTCATTATTTTTTTGCAGTTTCGTTTTTTGTGATTTGTATAAGCTGGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44820
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Nonsense 1158 2849 19 30
ENSDART00000045312 Nonsense 1133 2824 18 29
ENSDART00000146828 Nonsense 502 2193 9 21
Genomic Location (Zv9):
Chromosome 15 (position 10881246)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10187725
GRCz11 15 10110120
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGGTACAGATATGCGCTTGGGCTACTTGAGCAGCCGGACTTCTGGCTA[T/G]AAGTCTCTTCTGCGAATCACCCTCACCCACTCCACCATCCCGTTCAGCCT
Long Flanking Sequence:
GGAAAGGCAACAAGACTTTTGGTATGTAGTAATTATTTTGAAAAGCATTATTCCTTATTCACAGCAATAAAATGATAAAAAGGGATTACTTTTTTCACTGTATTACTAATCAAATATTTCAGTCTTACTGCACATAAGGGAGTTTTGAAACTTTTGAACAGCATTTAATTTTAACTTTTAATATAATAACTCAGAGGTGAATTATGGCCTAGATTCTCCCAATAATTAGTATTTCTTGCACGGTATAATAAAGCGTCTGCTCTGGAAAATAAATTAATTCCTTCTCATTTGCGTATATACCGGAGATGCTAAATAATGCAAACACTTCTCAGCAGGGTGCATCTCCCACAAAATTAACAGATTTGTTACTGTTCGCTCTGTTTTGTTGTAGCTAATTTCTTAATTTTCGCTTTACTCTCTCTCCAGACCCTCCAAGAAGAAGTGCGGATCCCAGGTACAGATATGCGCTTGGGCTACTTGAGCAGCCGGACTTCTGGCTA[T/G]AAGTCTCTTCTGCGAATCACCCTCACCCACTCCACCATCCCGTTCAGCCTGATGAAGGTGCACCTTATGGTGGCCGTTGAAGGAAGACTTTTCCGGAAGTGGTTTTCAGCTGCTCCCAACCTCTCTTACGACTTTGTTTGGGACAAAACCGACGTCTACAGCCAGAAAGTATATGGGCTGTCTGAGGCTTTCGGTAAGTGAGGAATGAAGTTTGTTATAGTCTCTTTCTTCAGAGCTGGTTCCTTAAAGTAATGGTCTAGACTCCCAATGTCTATCAGTGTATAAGTTCTGATTTGAAGAGCCACTTTGTGGAGTTTTAAAATCTTTTTTTTTTTTTTTTTTTTTTTTTCAAATTATTTAGTATGTATCGCTTGAAAATTGACACAATCACCCACACAGAATCTGCCCATCAAGATTTATTTACTTACAGTTGAAGTTAGAATGAATAGCCCTCCTTTGAATTTTCATGATTAACAGGGCAAGTAAATTTTCACAGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22594
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Nonsense 1326 2849 21 30
ENSDART00000045312 Nonsense 1301 2824 20 29
ENSDART00000146828 Nonsense 670 2193 11 21
Genomic Location (Zv9):
Chromosome 15 (position 10889992)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10178979
GRCz11 15 10101374
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGGCGGATGGAAACAAGCTGCTCGCACCTGTAGCTTTAGCTTGCGGGT[C/A]GGATGGCAGTCTGTATGTGGGAGATTTCAACTACGTCCGTCGCATCTTCA
Long Flanking Sequence:
CTATTGTGAATAGATTTGGGACTAAATAGAGTAAATACTGACATATTCTCTGTTTTTATGTTATGTAATGATTCTAAAGTTTTTATGACAGTCTTATAAAACCCCCTCAAGTAAAATGTTTCCTTTACTGCAAAAAGATGGCTGTTGTGAATAGATTTGGGACTAAATAGAGTAAATACTTGCATGTTCTCAGTTTTGTGTCATGTCATGACTACAAAGTTTTAACGACAGTCTTATGAACACCCCCTTCAAGTAATTAATGCAAAGAGATGGTTGTTGTGAATGGATTTGGTACTAAATAGATTACTTACATTTTCTCTGTTTTTGTCACCCAGGTATCCTTCACAAGGGCAACGGTGAGAACATCTTCATTTCCCAGCAGCCTCCAGTCATAGGAAGCATCATGGGTAATGGACGGAGGCGCAGTATCTCCTGTCCGAGCTGCAACGGGCTGGCGGATGGAAACAAGCTGCTCGCACCTGTAGCTTTAGCTTGCGGGT[C/A]GGATGGCAGTCTGTATGTGGGAGATTTCAACTACGTCCGTCGCATCTTCACAACGGGAAATGTCACCAGCGTCCTAGAGCTCAGGTTTGGCATTCTGCATGTGCATGGACACGCAAACAAAATGACAAGCTGTTTTGTACTCGTTAGACAAGTTGCTCACTAACTAAAAGGTGATCCGACTGTCAGTGTTTTAAGCTCGACTCATAACACAAGATTGATGCTGCTGGCCTTTTAGATTTGCAGAAATAGTTCGCCCAAAAATGAAATTCACCTCATTTTTAAACCTCTCTGACTTCGGAACTTGGATGTGTTCTACAGAAGAAAGTAACAGAATAATCATTTTTGGGTGAATTTAGTTCAGAATATCTTTCATCTTTCATTCAAACCCAAAAAGCACTCATACTGTTCATATACAGTACAAGGCATCTGTTTTAGGGGCTATATGTAGAGTTTGCAACAAAATAGTACCAAATGCACCAATAATTAAAAGCAAGCTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44821
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Nonsense 1361 2849 22 30
ENSDART00000045312 Nonsense 1336 2824 21 29
ENSDART00000146828 Nonsense 705 2193 12 21
Genomic Location (Zv9):
Chromosome 15 (position 10902688)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10166283
GRCz11 15 10088678
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTTTCCTGTTGTTTGTTTATTTTCTAGCAACAGCCCTGCACACAAATA[T/G]TACCTGGCCACCAGTCCTGTTTCAGGTTGGCTGTACCTCTCGGACACCAG
Long Flanking Sequence:
AATGCATCAACCCCAACTTCAGACCTAACCTCCGTGAAGCTTACACACTGAAGCAACACTGAAGCCCCTTGTGGATCGGGCGTTATTGCATTTAAGAATTTAATACATTTTATTAGTATTGCTAGCAAAACTTAAGTAAAGTTTAAAAACTTTTCTTTTTGTTTTGTTTTTATATTTGTAATTTTAAAAAAAGTTGGTGTATTTTGACTTTTTTTTTTGGCCTGTATTAGAATAGAAATTGTATAAAAAGCACACAAACATACTGAGTTATAGGTCCTGTACTGTACATTGTTATGGGTCAACGATGCTAATTTTTGGCTCAAATCCAGCAGTAACTAAGGAGGGAGGGGTTTAGCGAAGGGCCAATTGCTGTGAAAAATATTCCTGTATTAATGTACTAATATTACCAAACATTAATGTTTTGTTTTTTTCATTTACATTACAACTGACTTCTTTCCTGTTGTTTGTTTATTTTCTAGCAACAGCCCTGCACACAAATA[T/G]TACCTGGCCACCAGTCCTGTTTCAGGTTGGCTGTACCTCTCGGACACCAGCAGCAGGAAGGTGTTCAAAGTCAAGTCTCTGTATGCAGTGAAAGATGTGGCCAAAAACCTGGAGCTGGTGGCGGGAACAGGAGATCAGTGTCTGCCATATGACGAGACTCGATGTGGGGACGGAGGCAAAGCTGTGGAGGCCACACTCACCAACCCAAGAGGTATATCTCAGTCACATTACAGTTTTATATACATTTTTTTTAAATGCATAATAATTTTGGCATCACTGATTCAATTTATAACCCTATAATTTCCTTTAGCCCATGAGAAAATTATCTTAAATAAGAAGGTGCTGAAAAAAATGCTTCAGCCACACATTGTCCATTCTAAAAAAGTTTTTCATCCATATATTTGTGCCAAAACAAGCCCTGAGCATCAAAATTCAGAGCAAACCCCAAAACCACAGAATGAAACTGATAGCAAAAGCTGTGGTTTGTATTCGCTTGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12130
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Nonsense 1989 2849 27 30
ENSDART00000045312 Nonsense 1964 2824 26 29
ENSDART00000146828 Nonsense 1333 2193 17 21
Genomic Location (Zv9):
Chromosome 15 (position 10964140)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10104831
GRCz11 15 10027226
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATTGCTGGCATCCAGAGRGGCACAATGTCAGTCCGAATGGAATATGAC[C/T]AAAATGGGAGAATCACCTCAAAGATATTTGCAGATGGAAAATCATGGWGC
Long Flanking Sequence:
CTTCATATGCAGCTCAGAGGTGTTTTCCTCATCCTTCAAGTAGAATGGAAGTTATCTATTCCTCAGTAATTCTTTCCTGGAATGGGGATGATTACACTGAATGGAGTGTTTCTCTCATTCTTTTTGTTCTAACAAGCAGCAAGCAAAGAATTCAATCTTGGGTGCCCTAGAGGTGTGTGTTTGATAGTCAAAATCATTAAAGTGTAAGACATCACATTCAACCAAGTGTGCCTGTTCAATTCAGTGGTCTAATCTCTGTGTTCTTTTTGTAGGTTCATAATAGAAATTTGTTATCTATGGATTTCGATCGGGTAACCAGGACTGAGAAAGTGTATGATGACCACAGGAAGTTCACCTTAAGGATCCACTATGATCATGCTGGAAGACCTACATTGTGGGCTCCAAGTAGCCGGCTAAATGGTGTCAATGTTACCTACTCACCAGGTGGCCACATTGCTGGCATCCAGAGAGGCACAATGTCAGTCCGAATGGAATATGAC[C/T]AAAATGGGAGAATCACCTCAAAGATATTTGCAGATGGAAAATCATGGAGCTACACCTACCTTGAAAAGGTATGCACCTTTGACTGTAAAGCAATGCAACATCTGGTTAAACTTATTTCAATAATATGTTCTAACCTTGCCTGCATAGGTCCTCTCTCAAGTACAGCCATTGTTACCACAGACAGCTTGACAACTTGATCACTCCTAAGATATCACTGTAAAAAAAGTAAAATACCACTATCTTATTAGAACGAATATCTGAGAAATGCAGCACCTTATAGTGTAACTGAAAAATAGCATGTTGAAATGCTGACAACCCAATACACTGTTTTAAAAGAATTGATTGTTGTGTCTAAACTCGCTCTATTTAATATTTCTTGCCATTCTAAACTGACTACATGCCGGTGAGATCAATAGTCTCAAAGTAAAAAAGAGCAAAGCTCCTTCCTGCTGAAATCTAAACTCCATAATATCCTCCCACTGACCTCCATATAAGGTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42498
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Nonsense 2003 2849 27 30
ENSDART00000045312 Nonsense 1978 2824 26 29
ENSDART00000146828 Nonsense 1347 2193 17 21
Genomic Location (Zv9):
Chromosome 15 (position 10964183)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10104788
GRCz11 15 10027183
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATGACCAAAATGGGAGAATCACCTCAAAGATATTTGCAGATGGAAAAT[C/A]ATGGAGCTACACCTACCTTGAAAAGGTATGCACCTTTGACTGTAAAGCAA
Long Flanking Sequence:
AATGGAAGTTATCTATTCCTCAGTAATTCTTTCCTGGAATGGGGATGATTACACTGAATGGAGTGTTTCTCTCATTCTTTTTGTTCTAACAAGCAGCAAGCAAAGAATTCAATCTTGGGTGCCCTAGAGGTGTGTGTTTGATAGTCAAAATCATTAAAGTGTAAGACATCACATTCAACCAAGTGTGCCTGTTCAATTCAGTGGTCTAATCTCTGTGTTCTTTTTGTAGGTTCATAATAGAAATTTGTTATCTATGGATTTCGATCGGGTAACCAGGACTGAGAAAGTGTATGATGACCACAGGAAGTTCACCTTAAGGATCCACTATGATCATGCTGGAAGACCTACATTGTGGGCTCCAAGTAGCCGGCTAAATGGTGTCAATGTTACCTACTCACCAGGTGGCCACATTGCTGGCATCCAGAGAGGCACAATGTCAGTCCGAATGGAATATGACCAAAATGGGAGAATCACCTCAAAGATATTTGCAGATGGAAAAT[C/A]ATGGAGCTACACCTACCTTGAAAAGGTATGCACCTTTGACTGTAAAGCAATGCAACATCTGGTTAAACTTATTTCAATAATATGTTCTAACCTTGCCTGCATAGGTCCTCTCTCAAGTACAGCCATTGTTACCACAGACAGCTTGACAACTTGATCACTCCTAAGATATCACTGTAAAAAAAGTAAAATACCACTATCTTATTAGAACGAATATCTGAGAAATGCAGCACCTTATAGTGTAACTGAAAAATAGCATGTTGAAATGCTGACAACCCAATACACTGTTTTAAAAGAATTGATTGTTGTGTCTAAACTCGCTCTATTTAATATTTCTTGCCATTCTAAACTGACTACATGCCGGTGAGATCAATAGTCTCAAAGTAAAAAAGAGCAAAGCTCCTTCCTGCTGAAATCTAAACTCCATAATATCCTCCCACTGACCTCCATATAAGGTGACATTATTAAAAATGGTATCAGGAGAAGTGGTGAGGGGGAGGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35813
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Nonsense 2391 2849 28 30
ENSDART00000045312 Nonsense 2366 2824 27 29
ENSDART00000146828 Nonsense 1735 2193 18 21
Genomic Location (Zv9):
Chromosome 15 (position 10966117)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10102854
GRCz11 15 10025249
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGCTTGGGCAGAAGAGTGTCCAGTCGAAGTACCCAAGGCCACCATCTG[C/T]AATTCTTCTATGCAGACTTGTCCAGTCCCACCAGAGTCACACACATGTAC
Long Flanking Sequence:
ACTTTGATGCATACGGAAGAGTTAAAGAAGTGCAGTATGAGATTTTCCGTTCGCTCATGTACTGGATGATGGTACAGTATGACAACATGGGGCGAGTGGTGGCCAAGGAGCTTAAAGTCGGACCCTATGCAAATACCACCCGCTATGCCTATGAATATGATGCAGATGGTCAGCTCCAGGTAGTGTCCATCAATGATAAACCTCTATGGCGCTACAGTTATGACCTTAATGGCAATTTGCATCTCCTTAGCCCTGGTAATAGCGCCAGACTTACACCACTACGCTACGACATTCGGGACCGCATTACTCGTCTAGGTGATGTGCAGTACCGTTTAGATGAGGATGGATTCCTCAGGCAAAGAGGCAATGATTTCTTTGAGTATAACTCTGCTGGGTTGCTTGTTAAAACCTACAACAAAGTTAACGGATGGACTATCAAGTACCGCTATGATGGCTTGGGCAGAAGAGTGTCCAGTCGAAGTACCCAAGGCCACCATCTG[C/T]AATTCTTCTATGCAGACTTGTCCAGTCCCACCAGAGTCACACACATGTACAATCACTCAAGCTTAGAAATCACCTCACTCTACTATGACCTTCAAGGCCACCTTTTTGCCATGGAGTTGAGCAGTGGGGATGAGTTCTATGTGGCATGCGACAACATTGGTACTCCACTGGCTGTATTTAGTGGCGCTGGTCTCATGATCAAACAGATTCTCCACACAGCTTTTGGGGAAGTATATTTAGACTCCAACCCAAGCTTCCAGCTAGTAATAGGCTACCAGGGCGGCCTTTATGAGCCCCTTACAAAGCTTGTCCATATGGGCCGCAGAGATTATGATGTTCTTGCAGGCCGGTGGACCACTCCTGACCATGATATCTGGAAGCGGCTCAACAGCGACAACATTGTGCCCTTCAACCTCTACATGTTTAAGAACAACAACCCCTTGAGCAACAGCCAAGAAACCAAGTGCTACATGACAGGTAAGAATAATTTCTTATAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24976
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 Nonsense 2470 2849 28 30
ENSDART00000045312 Nonsense 2445 2824 27 29
ENSDART00000146828 Nonsense 1814 2193 18 21
Genomic Location (Zv9):
Chromosome 15 (position 10966355)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10102616
GRCz11 15 10025011
KASP Assay ID:
554-7451.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTCTCATGATCAAACAGATTCTCCACACAGCTTTTGGGGAAGTATATT[T/A]AGACTCCAACCCAAGCTTCCAGCTAGTAATAGGCTACCAGGGCGGCCTTT
Long Flanking Sequence:
GCATCTCCTTAGCCCTGGTAATAGCGCCAGACTTACACCACTACGCTACGACATTCGGGACCGCATTACTCGTCTAGGTGATGTGCAGTACCGTTTAGATGAGGATGGATTCCTCAGGCAAAGAGGCAATGATTTCTTTGAGTATAACTCTGCTGGGTTGCTTGTTAAAACCTACAACAAAGTTAACGGATGGACTATCAAGTACCGCTATGATGGCTTGGGCAGAAGAGTGTCCAGTCGAAGTACCCAAGGCCACCATCTGCAATTCTTCTATGCAGACTTGTCCAGTCCCACCAGAGTCACACACATGTACAATCACTCAAGCTTAGAAATCACCTCACTCTACTATGACCTTCAAGGCCACCTTTTTGCCATGGAGTTGAGCAGTGGGGATGAGTTCTATGTGGCATGCGACAACATTGGTACTCCACTGGCTGTATTTAGTGGCGCTGGTCTCATGATCAAACAGATTCTCCACACAGCTTTTGGGGAAGTATATT[T/A]AGACTCCAACCCAAGCTTCCAGCTAGTAATAGGCTACCAGGGCGGCCTTTATGAGCCCCTTACAAAGCTTGTCCATATGGGCCGCAGAGATTATGATGTTCTTGCAGGCCGGTGGACCACTCCTGACCATGATATCTGGAAGCGGCTCAACAGCGACAACATTGTGCCCTTCAACCTCTACATGTTTAAGAACAACAACCCCTTGAGCAACAGCCAAGAAACCAAGTGCTACATGACAGGTAAGAATAATTTCTTATAAATATTTTTGGAACATACTGAGAAGGACATTATTTGATATACCGACCCATCTCCAAATAGTTATGTGTAGGAATGCAGGGATGCTGGAGTCTATTCCAGCATCTTGAGCCAAAAATTTGGGGGCTTTTAATAATCTCCAAATATCTTTACTGTTACACTTTACCTGCAGCATTCTAAAACACCATAAGTACATGGTGCCAAGAATCCTCCTTGCACAACAGTGATTATTTTTCAGTCTCTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4592
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002791 None None 2849 30 30
ENSDART00000045312 None None 2824 None 29
ENSDART00000146828 Essential Splice Site None 2193 21 21
Genomic Location (Zv9):
Chromosome 15 (position 10987519)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10081452
GRCz11 15 10003847
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTTTAAWACATGACATACAMGRTTGCAAACAGTTKMACTGTTTCAACA[G/A]CAGAGTGCCCTTCTCTCTTTTGGTAATTCTTAAACCCTCTTTGCCCTTCA
Long Flanking Sequence:
GTTCGCGCCGCATAACTGACATCCAGATGCAATACGGTACTTTAAGCCTTAATGTACGCTACGGCAGCAGTGTGGATGAAGAAAAGGTCAGAGTTCTGGAGCTTGCACGACAGAGGGCGGTTGCAACCGCATGGGCCCACGAGCGCCACAGACTACGGCAAGGAGAAGAGGGCTCTCGGGCTTGGACGGACGGGGAAAGGCAGCAGCTCCTAAGCTCTGGACGTGTACAGGGCTACGAAGGCTTCTACATAGTATCAGTCGACCAGTTCCCAGAGTTGGCTGACAACATAAATAACGTCCATTTCTTGCGACAGACTGAGATGGGACGCAGGTGACATGAACGCGAAGGAAACCCTCGCTCGGACTCGACGTCCCAGACTTCTTGCCAAAGACAAGTTGCGTTTGTGACCATATTACGTTACTTTATTTTTATGTTAACTGTGCCAGACTTTTTTTAATACATGACATACACGATTGCAAACAGTTTAACTGTTTCAACA[G/A]CAGAGTGCCCTTCTCTCTTTTGGTAATTCTTAAACCCTCTTTGCCCTTCAAGTGCGGCTGCTAGAAGGTGGCATATGGCGGAGTCGGCGGTTTATGCCTTGGTGTTTGTGGGTTTGCTCAAAGGAATATAGGAAGAAGGCTGGTAATGCATTATGCTCACTGGCTCAGCCTGCTGCCAGACGAGCAGATTGTTATTCACGAGCTTCACTCTACTCTGCCTTTTCCTGCGCCTCAGCCAAGGAGAGACCTCTTTTAATCGCTTCTTTTTATACTTGAAAGCCCACCGGCTGTGTCATACTTAAACAAGAACATTGGTGTTTGCAGTGCATCGCTACCAGTTCAGATTCCTAACTGAACCCATCTCATGTTCAAAACTTGTTGTGGTGTCTTGTAATATTTTGGGACTGAGTGGTTTGCTGGTAACATCCTTTTATTATGATTTCCAGTTTTGACCAAATGGCTTAAAACACATAGGGAAAGGGAACTTAACTGACAAGAGT
Associated Phenotype:
Not determined