Busch Lab

ZMP

pld2

Ensembl ID:
ENSDARG00000034262
ZFIN ID:
ZDB-GENE-060216-4
Description:
Phospholipase D2 [Source:UniProtKB/TrEMBL;Acc:A2BG86]
Human Orthologue:
PLD2
Human Description:
phospholipase D2 [Source:HGNC Symbol;Acc:9068]
Mouse Orthologue:
Pld2
Mouse Description:
phospholipase D2 Gene [Source:MGI Symbol;Acc:MGI:892877]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26533
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039698 Essential Splice Site 158 368 5 11
ENSDART00000131912 Essential Splice Site 717 927 21 25
Genomic Location (Zv9):
Chromosome 5 (position 40002189)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37801579
GRCz11 5 38401732
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACGATTAATCGAGGAGAACACTCCATTCTTTCAAGATTAAAGGAACAAA[G/A]TAAGTATCTGACAGCATATTTAGCTGTCTGTAATTCACTCTAGTGCATTG
Associated Phenotype:
Not determined