Busch Lab

ZMP

esr2b

Ensembl ID:
ENSDARG00000034181
ZFIN ID:
ZDB-GENE-030116-1
Description:
estrogen receptor 2b [Source:RefSeq peptide;Acc:NP_777287]
Human Orthologue:
ESR2
Human Description:
estrogen receptor 2 (ER beta) [Source:HGNC Symbol;Acc:3468]
Mouse Orthologue:
Esr2
Mouse Description:
estrogen receptor 2 (beta) Gene [Source:MGI Symbol;Acc:MGI:109392]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa77 Essential Splice Site Confirmed mutation in F2 line Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28169
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041300 Nonsense 140 600 3 10
ENSDART00000063412 Nonsense 140 592 2 9
ENSDART00000131800 Nonsense 140 592 3 10

The following transcripts of ENSDARG00000034181 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 37441466)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36918278
GRCz11 13 37044168
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCTGTACCTTCATCTTTTCTAGTTCTGTCCTTAGTCATACAAAGCTGT[T/A]AGGACAGCAGCTAGAAGGTGACAATGGCTTGAATCCCTCCGCGAGCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa77
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041300 None 234 600 4 10
ENSDART00000063412 Essential Splice Site 234 592 3 9
ENSDART00000131800 Essential Splice Site 234 592 4 10

The following transcripts of ENSDARG00000034181 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 37449975)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36926787
GRCz11 13 37052677
KASP Assay ID:
554-0023.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGCCTGTCGACTCCGCAAGTGCTATGAAGTGGGCATGATGAAGTGTGG[T/C]ATGCAGCTGACTCTCCGCTTCTGTGTGTAGCCACATACTGTATTTATATA
Associated Phenotype:
Not determined