Busch Lab

ZMP

cpsf1

Ensembl ID:
ENSDARG00000034178
ZFIN ID:
ZDB-GENE-040709-2
Description:
cleavage and polyadenylation specificity factor subunit 1 [Source:RefSeq peptide;Acc:NP_001108153]
Human Orthologue:
CPSF1
Human Description:
cleavage and polyadenylation specific factor 1, 160kDa [Source:HGNC Symbol;Acc:2324]
Mouse Orthologue:
Cpsf1
Mouse Description:
cleavage and polyadenylation specific factor 1 Gene [Source:MGI Symbol;Acc:MGI:2679722]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa44909 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36798 Nonsense Mutation detected in F1 DNA Not yet available
sa23476 Essential Splice Site Available for shipment Available now
sa29173 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16124 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa44909
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024861 None None 985 None 24
ENSDART00000045987 Essential Splice Site None 416 None 12
ENSDART00000110017 None None 1451 None 37
ENSDART00000110513 Essential Splice Site None 400 None 15
Genomic Location (Zv9):
Chromosome 19 (position 12573605)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12031951
GRCz11 19 11950293
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGAGACCCAGTGGCCAAAGAGCATAACAATCGTACACTTATTCTGTGG[T/A]ATGTTCGAGTTTATTTATGCGTATCTTCACTTACTTTTGTTATTGTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36798
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024861 None None 985 None 24
ENSDART00000045987 Nonsense 54 416 3 12
ENSDART00000110017 Nonsense 54 1451 2 37
ENSDART00000110513 Nonsense 54 400 3 15
Genomic Location (Zv9):
Chromosome 19 (position 12568256)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12026602
GRCz11 19 11944944
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTAACATGAATCATTTTCCCTCATTTCATTCTAGAGCACTTCCAAGTCT[G/T]AAAAGTCATCAGGTAGGAATTTTACATGTATTTTTTTCTGCATTCAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23476
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024861 None None 985 None 24
ENSDART00000045987 Essential Splice Site 180 416 6 12
ENSDART00000110017 Essential Splice Site 180 1451 5 37
ENSDART00000110513 None None 400 None 15
Genomic Location (Zv9):
Chromosome 19 (position 12567461)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12025807
GRCz11 19 11944149
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGGAAGGACACGCTTGCTGACGAACAGGAGGGGATTGTGGGAGAGGGG[T/C]GAGAATAAATGTTTTCTAAATACTTGAAGACATTTCTTTTTTATTATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29173
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024861 None None 985 None 24
ENSDART00000045987 None None 416 None 12
ENSDART00000110017 Essential Splice Site 417 1451 11 37
ENSDART00000110513 None None 400 None 15
Genomic Location (Zv9):
Chromosome 19 (position 12561519)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12019865
GRCz11 19 11938207
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAAACACCCATGGAGGAGGGCAAAGAGAATGAGGAGAAGGAGAAACAGG[T/A]TTGTAATTAAGTTAATTTATTTCAATTTACAATTGCAATTAAATGTAATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29172
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024861 Nonsense 42 985 2 24
ENSDART00000045987 None None 416 None 12
ENSDART00000110017 Nonsense 508 1451 15 37
ENSDART00000110513 Nonsense 116 400 6 15
Genomic Location (Zv9):
Chromosome 19 (position 12556089)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12014435
GRCz11 19 11932777
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCAAACCAACCCTGAGCCAGATCTGGAGGTGGTGGTGTGTTCAGGATA[T/A]GGCAAGAATGGAGCACTGTCTGTATTACAGGTAAATGATCAGTTTTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16124
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024861 Essential Splice Site 436 985 10 24
ENSDART00000045987 None None 416 None 12
ENSDART00000110017 Essential Splice Site 902 1451 23 37
ENSDART00000110513 None None 400 None 15
Genomic Location (Zv9):
Chromosome 19 (position 12541088)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11999434
GRCz11 19 11917776
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTACGACCAGCARCAAGCTCARAGCAAYCTGAAAGTGCGCTTCAAGAAGG[T/C]ACARGCTGTATCAATAYTTACTCTCCTCAGGAWGTTTACTGTAATGGTAT
Associated Phenotype:
Not determined