Busch Lab

ZMP

actl6b

Ensembl ID:
ENSDARG00000034107
ZFIN ID:
ZDB-GENE-050522-191
Description:
actin-like 6B [Source:RefSeq peptide;Acc:NP_001018576]
Human Orthologue:
ACTL6B
Human Description:
actin-like 6B [Source:HGNC Symbol;Acc:160]
Mouse Orthologue:
Actl6b
Mouse Description:
actin-like 6B Gene [Source:MGI Symbol;Acc:MGI:1933548]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37795 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30005
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114640 Essential Splice Site 9 377 1 14
Genomic Location (Zv9):
Chromosome 23 (position 44610406)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44677855
GRCz11 23 44494375
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGGTCCGGATCAATCCTCACGCGATGAGCGGCGGCGTGTACGGCGGAGG[T/G]AAGAGCGATCCCGCATCACCATGACAACCGCATCCGCGAGCCGGCAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37795
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114640 Essential Splice Site 204 377 8 14
Genomic Location (Zv9):
Chromosome 23 (position 44595001)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44662450
GRCz11 23 44478970
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGACAAACTGCCTCCAGTCAGCAAGTCGTGGCACACGTTTATGTGTAAT[G/A]TAAGAGTCCACAACGGTGTGTGTGTGCACGTGTGTGTGTGCACATGTGTG
Associated Phenotype:
Not determined