Busch Lab

ZMP

zgc:63546

Ensembl ID:
ENSDARG00000034070
ZFIN ID:
ZDB-GENE-031030-8
Description:
cytochrome P450 CYP2AA3v1 [Source:RefSeq peptide;Acc:NP_001073321]
Human Orthologues:
AC008537.2, CYP2A7P1
Human Description:
cytochrome P450, family 2, subfamily A, polypeptide 7 pseudogene 1 [Source:HGNC Symbol;Acc:2612]
Mouse Orthologues:
Cyp2ab1, Cyp2j13
Mouse Descriptions:
cytochrome P450, family 2, subfamily ab, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3644957]
cytochrome P450, family 2, subfamily j, polypeptide 13 Gene [Source:MGI Symbol;Acc:MGI:2385197]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa44050 Nonsense Mutation detected in F1 DNA Not yet available
sa31096 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44050
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012284 Nonsense 111 496 2 9
Genomic Location (Zv9):
Chromosome 23 (position 42833817)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42517142
GRCz11 23 42482638
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGGTTCAGGATACTTTTTCTGGGAAGCCATATCTGCCTGTTATAGAGT[G/A]GATATCTAAAGGATTCGGTCAGTAACACTTTACTTATTAAAGCTTCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31096
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012284 Essential Splice Site 117 496 2 9
Genomic Location (Zv9):
Chromosome 23 (position 42833798)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42517161
GRCz11 23 42482657
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGGGAAGCCATATCTGCCTGTTATAGAGTGGATATCTAAAGGATTCGG[T/A]CAGTAACACTTTACTTATTAAAGCTTCCAATTGAAAGATTTCACAGACAT
Associated Phenotype:
Not determined