Busch Lab

ZMP

cyp26a1

Ensembl ID:
ENSDARG00000033999
ZFIN ID:
ZDB-GENE-990415-44
Description:
Cytochrome P450 26A1 [Source:UniProtKB/Swiss-Prot;Acc:P79739]
Human Orthologue:
CYP26A1
Human Description:
cytochrome P450, family 26, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2603]
Mouse Orthologue:
Cyp26a1
Mouse Description:
cytochrome P450, family 26, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1096359]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa1738 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1738
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041728 Nonsense 218 492 3 7

The following transcripts of ENSDARG00000033999 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 9711087)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8919042
GRCz11 12 8956885
KASP Assay ID:
554-1683.1 (used for ordering genotyping assays)
KASP Sequence:
GACGGACGAGCAAGAACTGGTGGAAGCTTTTGAGGAAATGATCAAAAACT[T/A]GTTCTCCTTGCCAATCGAYGTTCCTTTCAGTGGTCTGTACAGGGTGAGTT
Long Flanking Sequence:
TTTGCTTCTTACAAAGATACATGCATTTTTGCTGCTTTAATAATATGAATGTTTGACACTCACTCATGTGTGAAACTTAATGTTAAATATTTTATATATTAAATATAGAATAAATATGATATATTTATATAGTAATTTTAAAATTAACATTTTATATATTACTCAATATAAAATATGAAATATTTGAGCATCTTCAAAAATGCAGATTGTCTGATATAATTATTTTGGAAATTAAAAGTTTTTTCTTCTTCTTCTGTTTTAGGCCATTATGAGGGCGTTCTCTCGAGATGCTCTGGAGCACTACATTCCCGTGATCCAGCAGGAGGTGAAGAGCGCCATACAGGAATGGCTGCAAAAAGACTCCTGCGTGCTGGTTTATCCAGAAATGAAGAAACTCATGTTTCGGATAGCTATGAGAATCCTGCTTGGTTTTGAACCAGAGCAAATAAAGACGGACGAGCAAGAACTGGTGGAAGCTTTTGAGGAAATGATCAAAAACT[T/A]GTTCTCCTTGCCAATCGACGTTCCTTTCAGTGGTCTGTACAGGGTGAGTTACTCAGAACAAATGTCTGAAGATGCATTCTCAATATGCGATACTCTTAAACTCAACTTGTGTGATTTTTGATCGGCAGGGTTTGAGGGCACGCAATTTCATTCACTCTAAAATTGAGGAAAACATCAGGAAGAAAATTCAAGATGACGACAATGAAAACGAGCAGAAATACAAAGACGCTCTTCAGCTGTTGATCGAGAACAGCAGAAGAAGTGACGAACCTTTTAGTTTGCAGGTAGTGTATTATTTTTATATTATTCTGTGCCCCACAAAAAGTACGATTCAGTGCTAATGTGATGTTTCGTATTGCTTAGGCGATGAAAGAAGCAGCTACAGAGCTTCTATTTGGAGGTCATGAAACCACCGCCAGTACTGCAACCTCACTAGTCATGTTTCTGGGTCTGAACACAGAAGTGGTGCAGAAGGTCAGAGAGGAGGTTCAGGAGAAGGT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3831
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041728 Nonsense 264 492 4 7

The following transcripts of ENSDARG00000033999 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 9710865)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8918820
GRCz11 12 8956663
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATCAGGAAGAAAATTCAAGATGACGACAATGAAAACGAGCAGAAATAC[A/T]AAGACGCTCTTCAGCTGTTGATCGAGAACAGCAGAAGAAGTGACGAACCT
Long Flanking Sequence:
TTTTGGAAATTAAAAGTTTTTTCTTCTTCTTCTGTTTTAGGCCATTATGAGGGCGTTCTCTCGAGATGCTCTGGAGCACTACATTCCCGTGATCCAGCAGGAGGTGAAGAGCGCCATACAGGAATGGCTGCAAAAAGACTCCTGCGTGCTGGTTTATCCAGAAATGAAGAAACTCATGTTTCGGATAGCTATGAGAATCCTGCTTGGTTTTGAACCAGAGCAAATAAAGACGGACGAGCAAGAACTGGTGGAAGCTTTTGAGGAAATGATCAAAAACTTGTTCTCCTTGCCAATCGACGTTCCTTTCAGTGGTCTGTACAGGGTGAGTTACTCAGAACAAATGTCTGAAGATGCATTCTCAATATGCGATACTCTTAAACTCAACTTGTGTGATTTTTGATCGGCAGGGTTTGAGGGCACGCAATTTCATTCACTCTAAAATTGAGGAAAACATCAGGAAGAAAATTCAAGATGACGACAATGAAAACGAGCAGAAATAC[A/T]AAGACGCTCTTCAGCTGTTGATCGAGAACAGCAGAAGAAGTGACGAACCTTTTAGTTTGCAGGTAGTGTATTATTTTTATATTATTCTGTGCCCCACAAAAAGTACGATTCAGTGCTAATGTGATGTTTCGTATTGCTTAGGCGATGAAAGAAGCAGCTACAGAGCTTCTATTTGGAGGTCATGAAACCACCGCCAGTACTGCAACCTCACTAGTCATGTTTCTGGGTCTGAACACAGAAGTGGTGCAGAAGGTCAGAGAGGAGGTTCAGGAGAAGGTAAGATCTAAGAAGTTTCATTCTGAGTTTGATGATGTTACTCAATCAGGGCCAGGGCTAATGTTAAATTTGCATTGACAGGTTGAAATGGGCATGTATACACCGGGAAAAGGCTTGAGCATGGAGCTGTTGGACCAGCTGAAGTACACTGGATGTGTGATTAAAGAAACTCTCAGAATCAACCCTCCTGTTCCTGGAGGATTCAGAGTCGCACTCAAAACCTT
Associated Phenotype:
Not determined