Busch Lab

ZMP

zgc:63948

Ensembl ID:
ENSDARG00000033928
ZFIN ID:
ZDB-GENE-040426-2662
Description:
NEDD4 family-interacting protein 2 [Source:RefSeq peptide;Acc:NP_998512]
Human Orthologue:
NDFIP2
Human Description:
Nedd4 family interacting protein 2 [Source:HGNC Symbol;Acc:18537]
Mouse Orthologue:
Ndfip2
Mouse Description:
Nedd4 family interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1923523]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15053 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15053
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103724 Essential Splice Site 140 237 4 8
ENSDART00000132595 None None 114 None 3
Genomic Location (Zv9):
Chromosome 1 (position 4258542)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 4671583
GRCz11 1 5369388
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATCAGCTGAGAGTGGGAAATGATGGGATCTTTATGCTGGCCTTYTTCAG[T/A]AAGTCATGTATACTCTTTATGGGTCAAAGACCGGCATCAANNNNNTGTAGTATAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25511
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103724 Nonsense 155 237 5 8
ENSDART00000132595 None None 114 None 3
Genomic Location (Zv9):
Chromosome 1 (position 4254989)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 4668030
GRCz11 1 5365835
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAGTGGCCTTTCTTTTCAACTGGATCGGGTTTTGCTTGTCCTTCTGTT[T/A]GACCAATACCATTGCTGGTCGATATGGTGCTATCTGCGGCTTTGGCCTTT
Associated Phenotype:
Not determined