Busch Lab

ZMP

derl3

Ensembl ID:
ENSDARG00000033871
ZFIN ID:
ZDB-GENE-040426-1324
Description:
Der1-like domain family, member 3 [Source:RefSeq peptide;Acc:NP_957197]
Human Orthologue:
DERL3
Human Description:
Der1-like domain family, member 3 [Source:HGNC Symbol;Acc:14236]
Mouse Orthologue:
Derl3
Mouse Description:
Der1-like domain family, member 3 Gene [Source:MGI Symbol;Acc:MGI:1917627]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa16948 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16948
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043251 Essential Splice Site 108 247 4 7
Genomic Location (Zv9):
Chromosome 8 (position 31771924)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30914650
GRCz11 8 30923882
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAACAGCAGATTTCGTTTACATGTTCCTGTTTGGTGGTGTTCTCATGACC[G/T]TATCCTTCAGAATACACAACATTAAATATCAGTTTAACATCATAATTTAT
Associated Phenotype:
Not determined