Busch Lab

ZMP

nt5c1bb

Ensembl ID:
ENSDARG00000033742
ZFIN ID:
ZDB-GENE-030131-7205
Description:
Novel protein similar to vertebrate cytosolic 5'-nucleotidase IB (NT5C1B) [Source:UniProtKB/TrEMBL;A
Human Orthologue:
NT5C1A
Human Description:
5'-nucleotidase, cytosolic IA [Source:HGNC Symbol;Acc:17819]
Mouse Orthologue:
Nt5c1a
Mouse Description:
5'-nucleotidase, cytosolic IA Gene [Source:MGI Symbol;Acc:MGI:2155700]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa3053 Nonsense F2 line generated Not yet available
sa36980 Nonsense Mutation detected in F1 DNA Not yet available
sa23641 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3053
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039966 Nonsense 146 364 4 6
ENSDART00000148017 Nonsense 116 334 4 6
Genomic Location (Zv9):
Chromosome 20 (position 9462906)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9297175
GRCz11 20 9284914
KASP Assay ID:
554-2584.1 (used for ordering genotyping assays)
KASP Sequence:
TAATATGGTGYTAATAGAAAGATTCTCTTCTTCCAGATCTGACCATAGAG[C/T]GATTCTGCATGACTGGAGGTCAGAGTCCCATCGGCTACCTCAAAGCCTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7929
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039966 Essential Splice Site 182 364 4 6
ENSDART00000148017 Essential Splice Site 152 334 4 6
Genomic Location (Zv9):
Chromosome 20 (position 9463016)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9297285
GRCz11 20 9285024
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGTATCTCTCCAGAGATTCCAAGAAAGTCGGGGAGGCCATCGAGGAAGG[T/A]AAGCTGATAACAAACTYACARTTGTTACATGACTAYTRCAGCCTGTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36980
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039966 Nonsense 214 364 5 6
ENSDART00000148017 Nonsense 184 334 5 6
Genomic Location (Zv9):
Chromosome 20 (position 9469040)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9303309
GRCz11 20 9291048
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAGAGACACAGCTGCGTGTCGCATTTGATGGAGACGCTGTGCTCTTCT[C/A]GGATGAGTCTGAGATCATAGTGAAACAGCACGGCCTGGACACCTTCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23641
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039966 Nonsense 246 364 6 6
ENSDART00000148017 Nonsense 216 334 6 6
Genomic Location (Zv9):
Chromosome 20 (position 9478576)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9312845
GRCz11 20 9300584
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATAGATCTTCAGACTCAATGCATCCCTTTATATTTCTTCAGGGTCCTT[T/A]AAAATGCTTCCTGGAGGCTCTCGGGAAGCTCCAGAAGAAATTCTATGCCA
Associated Phenotype:
Not determined