Busch Lab

ZMP

il12ba

Ensembl ID:
ENSDARG00000033727
ZFIN ID:
ZDB-GENE-050525-3
Description:
interleukin 12B [Source:RefSeq peptide;Acc:NP_001007109]
Human Orthologue:
IL12B
Human Description:
interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2,
Mouse Orthologue:
Il12b
Mouse Description:
interleukin 12b Gene [Source:MGI Symbol;Acc:MGI:96540]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa31998 Nonsense Available for shipment Available now
sa18013 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28342
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047524 Essential Splice Site None 324 1 8
ENSDART00000115105 Essential Splice Site None 350 1 8
Genomic Location (Zv9):
Chromosome 14 (position 36109623)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34610951
GRCz11 14 34951265
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCTTGTGGAGGATCATCTTGCTGGATAGTTTTTGACTTTTGATCAAAG[G/T]TAAGTCTCATTTCCGAATATTAATAAAAGTTTATCGAAAACATTTGTCGT
Long Flanking Sequence:
TGGAAAAACCAGCTGACAGCAGGGTTTAGCCGGGACAAACAAACAGGTAACGCAACCAGGTAAATCATCATCCAGCTTTCAGATGAGAACTTGTAGCAAAAATCCCCCCCCCCAAAATATTGACTTAACACCTTTAAATCTCCATTACTTGCTGCAAACCAATTAGCCGAGTCTTGTGTTTTATATATAAGCTGAAACAGATGTGGAATACTGTTTTGAATGGGCTGTGGTGTTTAACAGATAATCAGTCTATTATTAGAGATAGTAAAGGAAGGCACAGTGGAAGTAGAAGCAACTTGATTAATAAGGAAAGCTCAGGTCCTGCAGTTGCTCATGCAGGGTTTGCTTCCTCTAACCTGTGCTGGACTTTTCCTGGTTGGGGAAATTCTGCAGTCCTGACACTTAGCTTAAAAGCTTGCATGTTAAACACAACAACTAATCAAAACCAGTCTGCTTGTGGAGGATCATCTTGCTGGATAGTTTTTGACTTTTGATCAAAG[G/T]TAAGTCTCATTTCCGAATATTAATAAAAGTTTATCGAAAACATTTGTCGTAAATACTATGCATTTTATAAAAGTATTTAGTTCAATTATTGTTGAATGCCTTGAGAAATATAGATACAGTTGAAGTCAGAATTATTAGCCCTCCTGTTTATTTTTCCCCAATTTCTATTTAGTGGAGAGAAGAATTTTTTTACACATTTAATAACAACATAATAGTTTTAATAACTCATTTCTAATAACTGATTTATTTTATCTTTGCCATGATGACAGTAGATAATATTTTACAAGATATTTTCCAGACACTTCTATACAGCTTAAAGTGACATTTGAGGGCTTAACTGGGTTAATTAGGTTTACTAGGCAGGTTTGGGTAATTAGGCAAATTATTGTATAACGATGGTTTGTTCTGAAGACAGTCGAAAAGATATATAGCTTAAAGTGGCTAATAATTTTGACCTCAAAACGGGTTTTAAACAATTAAAAACTGCTTTTATTCTAGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28343
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047524 Essential Splice Site 121 324 3 8
ENSDART00000115105 Essential Splice Site 121 350 3 8
Genomic Location (Zv9):
Chromosome 14 (position 36111739)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34613067
GRCz11 14 34953381
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGGCCCAGTGGAGCTTTAGGAAGATCATCAGAAACACTCCTGAGAAAG[G/A]TAAAAGCATCATTTTTGTAACACATCTGAAGATCAGAGATGAAAAGGGGT
Long Flanking Sequence:
AGATGTTTCTTCTTAGGTTAAGAACGTTGTTTTGTCTTTATTCGTTGGCTGTAGGATCCATCCAAACATCTGAGAGCTTCTGGAAACTCAAACCAAATGGTAAAACTCACATCAAATTTTTACAAAAATACCCCATGTTATGTTTTGTTAACTGCTGAGATAACTTTTAATTGCATTGGGCTTGCTTTAACATTCTTTCACTTCACATTTGTTTTTCGTTCGTCTGTCGACAGTGCTTGTGGTGGATGTTGATGTAAAAGGTGTAAATAGGGTAGAAGTGCCAGTGATCTGTGGAGAAGCGTATGAAGGGCATAATATCACATGGACCAAAAACAAAGATAAACATCTGGAGGCTCAGGGAAACAGGATTACGGTGACGGTGGAGGGGTGGAAAGGGGCCAATTACTCCTGTTTCGACAATGAGGGCTCCTACCTGAACCACACACTGGTTCTGGCCCAGTGGAGCTTTAGGAAGATCATCAGAAACACTCCTGAGAAAG[G/A]TAAAAGCATCATTTTTGTAACACATCTGAAGATCAGAGATGAAAAGGGGTTTTCAGGGATTAAAATAATAAGTGCCTTGATAAGTTTTTTTTTTTTTGTCATTGCTATGGATAGTCCTGTTTGTTTTGTTTTTTTTTTGTATATGCTTATATACTGTTAAAATATTTTTATGTTGGGAAAACATGAAGGAATTATGTAGCTTAAAATTTAAGGCGATTAAACTGAAAACAATTAAGTTGTCATAAAACAACTGAACAAACAGTAAACGTCATTTTTGAGTGTATAGTTTTTATATTTCAATATGCTATACACTTGTTTATTATTTATAAACAGTTTATTTGGCATTACAATACTAAGTAGTCTATAGATTAAATATATTGGGGTCATTTTTTTTTGTTTGTAAAAGCCAGTAATATTGTGATTTTTGTTTATTTTTTTCAAATATGTAAACATTTATTTATTCATCATTCTTTACTGCATCATTGTCACATAATCCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31998
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047524 Nonsense 137 324 4 8
ENSDART00000115105 Nonsense 137 350 4 8
Genomic Location (Zv9):
Chromosome 14 (position 36112451)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34613779
GRCz11 14 34954093
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGGTTACATCCACTGTGCAACAAATAATTATGGAGGATTTTTCCAATG[T/A]TCATGGTCGTGGGGTGAGAACAGACATGGCCATATTACTCACATTGAAGC
Long Flanking Sequence:
GGCGATTAAACTGAAAACAATTAAGTTGTCATAAAACAACTGAACAAACAGTAAACGTCATTTTTGAGTGTATAGTTTTTATATTTCAATATGCTATACACTTGTTTATTATTTATAAACAGTTTATTTGGCATTACAATACTAAGTAGTCTATAGATTAAATATATTGGGGTCATTTTTTTTTGTTTGTAAAAGCCAGTAATATTGTGATTTTTGTTTATTTTTTTCAAATATGTAAACATTTATTTATTCATCATTCTTTACTGCATCATTGTCACATAATCCTTCAGAAATCATATTAATTATAAAGAACAATATTTATTTGAAATATTTTTTAACTTTAGCAAGTTGTTGTTAATTTAATTTGTCTTTGGTTTTCCTAACCCCAAATGTTTTTTTAGTGTTAGAAAATGTTTAAAGTTTGTTAATTCTTTTTATTTAATTATCAACCAAGGTTACATCCACTGTGCAACAAATAATTATGGAGGATTTTTCCAATG[T/A]TCATGGTCGTGGGGTGAGAACAGACATGGCCATATTACTCACATTGAAGCTATACGGTATGTTTCCCAGACTTTCTCTGCCATCTTGACGATAACGGTGCACTGAAAAAAGTGTTGCATGCAGAACTGTTGCAAACAATTTATTTGTGTTGAATTTAAACAAACAAATTATGTTTAATAATGTTCAACTTAGTGTGTTTGTTTAAATTCAACACAAATAAATTGTTTACAACCACTTAACGTAAAAAAATTGAGTAAATCCAAGGAATCATCTTTGAATAATTTTTTTCAGTGTGTGTAGAAGTAAATCCATAAATACATAAAGAAAGAAAGAAAGAAATAAAGAAAGAAAACTTGATTGTTTCTTTTCCAGGCCTGATGGTGGAAGCAACATCAGCTGCAGTCTGGATCCCGGAGGAAAGAGTATCACCTGCTTAGACCAAGACTACTGTCCATATGCAGAGGAGCTGGAGCGCATCAACCTCACTGTTTACTTCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18013
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047524 Nonsense 257 324 6 8
ENSDART00000115105 Nonsense 257 350 6 8
Genomic Location (Zv9):
Chromosome 14 (position 36114224)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34615552
GRCz11 14 34955866
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACACCATCATCTTACTTCCCTCTYATCTTCCAARTGAARGAGATTCGCTG[T/A]AGGAAACGCAAAAAATGTGACTGCTCCCAACTGAGMTCAATAGAGGTACT
Long Flanking Sequence:
AACTAATCATAGGAAAGTACTGCTGAGAATATTTTTTTCCTATTGTGAAATTGGAAGTATAGGCCTAATGTGTAACTATAACAATTCTGGGTGATTTCAAATAAAAGGCAAATGGACAATATAATAGATAAGATGACCTGAATTTGATTTGAGTAGTCCTGAGACTTAACAGCAATGTCTTTAGCTTTGAGCAATCGTATCGATTCTAACTCTGGTCTGTTTTCAGTCTTGGTTTTGGTTTTGGTCTTGATGCCCACTGGTCTTTGCAGTGTCTTGGTCTTGACAGCCTCCGTTCTCAGCAATGTCTTAATCTTAGTCTAGCCGGTCTTGAATACAACACTAACTTGTATAATTATAAATGAATGCTGTTTTTCAGTGAAACCGGACATGGTGGCTATTAGCAGGATCAATCATACATGCGTAGAAGTGGGATACCCAGACTCCTGGAACACACCATCATCTTACTTCCCTCTCATCTTCCAAGTGAAAGAGATTCGCTG[T/A]AGGAAACGCAAAAAATGTGACTGCTCCCAACTGAGCTCAATAGAGGTACTGTGACTCCAGCCTGATCTCGCAAGGAAGCGTATCAGTTTAGTGGCTAATTCATCAATTTCTGTGTAAACTTTGCATGTTCTCCCCGTGTTCGCATGGGTTTCCTCCAGGTGCTTTAGTTTTCCCCACAGTCCAAAGTAGAGATCTGCACGGGACAAAATTTTGAATCCCGCTCTACCCAGGTTTTAGTCTGAACCCGACCGCTCCCGCTTATATTCAGCATTTGTTGTCCCGCTGCCTGACCAGTCCCCATTTCTACCAGCTGCGCCCGTTCCCGCTAATGGGCGGGGGGAGAACAAAATCGAAAAGTCCAGACAGCCTTTAACAAGCTGGATGTATAAACACACACACACACAAACACATAGACACACAGCACCAAGCAAGTGACACACACACAGACAGCATCATGCTCTCTCTTGTATACACACATACACACACACGCACAGAGAGCA
Associated Phenotype:
Not determined