Busch Lab

ZMP

api5

Ensembl ID:
ENSDARG00000033597
ZFIN ID:
ZDB-GENE-030131-395
Description:
apoptosis inhibitor 5 [Source:RefSeq peptide;Acc:NP_955834]
Human Orthologue:
API5
Human Description:
apoptosis inhibitor 5 [Source:HGNC Symbol;Acc:594]
Mouse Orthologue:
Api5
Mouse Description:
apoptosis inhibitor 5 Gene [Source:MGI Symbol;Acc:MGI:1888993]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa30752 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30752
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005913 None None 188 None 6
ENSDART00000139447 Essential Splice Site 407 529 10 14
Genomic Location (Zv9):
Chromosome 25 (position 31135898)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29703259
GRCz11 25 30146266
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCGTGTTGCTCTGCAGGGCAAGACTGGAGATGCGTTGAAAACAGATGAG[G/A]TATGATTTAACTTTTTGCAAAGATCTATGTAAAGGTAATGCAAATCTTTC
Associated Phenotype:
Not determined