Busch Lab

ZMP

ido1

Ensembl ID:
ENSDARG00000033594
ZFIN ID:
ZDB-GENE-080228-2
Description:
indoleamine 2,3-dioxygenase 2 [Source:RefSeq peptide;Acc:NP_001077323]
Human Orthologue:
IDO2
Human Description:
indoleamine 2,3-dioxygenase 2 [Source:HGNC Symbol;Acc:27269]
Mouse Orthologue:
Ido2
Mouse Description:
indoleamine 2,3-dioxygenase 2 Gene [Source:MGI Symbol;Acc:MGI:2142489]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa12360 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27279
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056361 Nonsense 4 435 1 10
Genomic Location (Zv9):
Chromosome 8 (position 52312509)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50494055
GRCz11 8 50482701
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTAACCAGAGAGTCTGTCACTAGTATTAAAGTGAACATTATGGGTACC[G/T]AAGTGAAAGCTACAAGGACAGTAGTGTCTCTTAGAAAGTTTCACATCTCT
Long Flanking Sequence:
TATTTCTATAGCGCTTTTACAATGTATGTGTCAAAGCAGCTTCACATAGAAGGTTATAGTGAATTGAAACGGTGTCTGTTCAGTTTTATTATTATTAAGGATATTTTTTTAATTATTAAGGATTTTTTGTCAGGAATGTATTTCAGGATTGTTATTGCTCAACGTGTTACCTTTGAGAACAGATAATTGCATGCCAAAACACACTTAAATATTCATTTAGCTTATGAAAGCACCTTTTGATTAGAAGACAGAAATTCCCTTGTATTGCAGGTTCTGCCTCTTGTTTAAGTGGTTTTATTCACATGTTCTCATATGCTTTCAGATAAGGGAAGTGAGGAAAGGTCATAGTCAACGGTAAAATAAAAACAGACAGACAGATAGAGAGAGAGAGAGAGATTTGCCACCCGATCAGCAAGGTTCATTCGACTATAGAGCGCTAACAGTAGCACCTGCTAACCAGAGAGTCTGTCACTAGTATTAAAGTGAACATTATGGGTACC[G/T]AAGTGAAAGCTACAAGGACAGTAGTGTCTCTTAGAAAGTTTCACATCTCTGAAGAATATGGGTTTATTCTTCCTGAGCCTCTGGTAGGTCATTTCTTTTATACTAATCTGTTTACACATCTGTTTAGTTTTCATAGAGAAACGCTGCTGTTTTTATGCTGTGTACAGCAAAGAAACATTAGTAAAATGTTCATTTATGTATTTACTTATGTACTCTGACTGCACTATTTAGTTTTATTGCTTGTACGTTGATATGATCCAAATCACTGTGTCATTGGGAATGCTTTAAAACAGAACAAGTTAGCTTTTTTGTTGAAAATAATGCGATTTCTTTGTAGGACTGGGCTGTGTAGCTACACAATAAAAAAAATCCTGGTTGCCTTAAATTTTTTTAGCTGAATCAAATAATATTGTGAGTCCATTAAACTTATATTAAATTGAACTGACTTAAAACAGCGTGTGTAACTTAAAAAATTAAGTTAGGACATGATTAACTTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12360
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056361 Nonsense 222 435 8 10
Genomic Location (Zv9):
Chromosome 8 (position 52328278)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50478286
GRCz11 8 50466932
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGARATAATCACAGGAGGACTTCAAAAGTHTGTCTTACTCTTTCAGAATA[T/A]GTAGATCCCTCCATATTCTACGGCGTTATAAGGATCTTTCTTTCTGGGTA
Long Flanking Sequence:
AAATTTAACTGCAGCAAACTATAAAAGCAACACTTCACGCTTGTTTTGCCAACACAACGTGGCGTCTCTGTCGTCTAAACACTGTGACAGTAATGAATATTAATGAAGTTGCACAATAGGGCGCGCTGATTGGTTTGAACCAAGCTTTACTCATGCATTAATGCATCACACTGTAAGACGTAATAAGACACACTCTGGCACAGACGTCCAGTCTGCACGCTGGAATACACGCTAATATGTCATGTCCATGACGCAGCTTCAAAAATTTGTTTCATACCGGAAGTACGAATTTGCTTGAAATAACGCAAAAACAACCAATTTACACTTTTTAGTGAAATATAGGTGTCCTAATAGTGTTTTTAGCAGTGTGGGACACATATACGACTGTCGACAGCTCAAAACATGTGTTTTGGTGTTTCGTGACCCTTTAAATATAAGTTGGGAAATATTTGAAATAATCACAGGAGGACTTCAAAAGTCTGTCTTACTCTTTCAGAATA[T/A]GTAGATCCCTCCATATTCTACGGCGTTATAAGGATCTTTCTTTCTGGGTAAGCTGTACTCTAGGGTTGTTATCCTTTAAGTTCCTCTAAATGGATGATATGCTCATCTCTTTCTGCTTGTGGTTGTTAGATGGAAAGATAACCCGTCGATGGCTGAAGGTCTGGTGTATGAAGGAGTTGATGATCAGCCTATGGAGTTTTCTGGAGGCAGTGCAGCACAGAGCAGCATCTTACACTGCCTTGATGAGCTGCTGGGAATCCAACATGAAGGCAACAATGGTAGGAGAATCATCCCTAAATCTGCTCGAGGTTATTATGCACACTGTAAAAATATAGTAGGAAATTAGCAGTTTTCCGTATTTTTATTATTTTTCCCTGTTTATTAATGCTTCTAAATCACATTATGAGACCTCAATCTTTTTAATTTTTTCTTTCTACCTCAAAAAGTGACCTTTTTTGCCATTTTTAATAGTTGTCATTTTTAATCAGGGGTGCCCAAAT
Associated Phenotype:
Not determined