Busch Lab

ZMP

zgc:73254

Ensembl ID:
ENSDARG00000033586
ZFIN ID:
ZDB-GENE-040426-1732
Description:
Pyridine nucleotide-disulfide oxidoreductase domain-containing protein 1 [Source:UniProtKB/Swiss-Pro
Human Orthologue:
PYROXD1
Human Description:
pyridine nucleotide-disulphide oxidoreductase domain 1 [Source:HGNC Symbol;Acc:26162]
Mouse Orthologue:
Pyroxd1
Mouse Description:
pyridine nucleotide-disulphide oxidoreductase domain 1 Gene [Source:MGI Symbol;Acc:MGI:2676395]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa7011 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26596
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042663 Nonsense 25 489 2 13
Genomic Location (Zv9):
Chromosome 5 (position 62705988)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 70516590
GRCz11 4 72035984
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACAAGTCAAGTTCGTGATTGTAGGTGGAGGAATCGCAGGTGTCACTTG[T/A]GCAGAACAGGTAAGAAACCATCGATTAATATATCATTAAACCTTTATTTC
Long Flanking Sequence:
GGAGATCTCTGCATGAAAGACTAGCGAATGGCAATAACCTGGAAATATTTCATATCAAATAAATATTTGGTTTCAAGTAATGTGGATGATGTGTCGAGATGATTGACAAACTAAGCAACATATCGTTAATGCGGGAAGTATGTACTTTTTCTTCACAAAAAAAAGTACTTCAAAGTATTTGGGACGCAGCTAATGCGTAGCGCAAACCGTTTGACCCTCAATGCTTCCTGTAGTCAGCTGAAAGTGGGTAAACACGGAAGTCAGTTCGCTCTAAATATAGCTGCTCTTTATACCTCTGTTTTTATTTAATATGTTTATATGAGAGACAAAAAACAAGATCGATAAAAAGATCGAAAAAATTGAGCATTTCGATAGTTTGAGTCGAGCATTTCGTTCGTTGTTCCTATCTGTAAACAGATCTCCATGTGCTGAAGTTCAATGGCTTCAGAGAAACAAGTCAAGTTCGTGATTGTAGGTGGAGGAATCGCAGGTGTCACTTG[T/A]GCAGAACAGGTAAGAAACCATCGATTAATATATCATTAAACCTTTATTTCGATGCTCTATCTTAGTCATTCTGCCGACTTGAAGTAACTTTGCAAGTACGACAAATAGTCGTTAAATTATTGATAGATTAACGTTAGTATTTGGTACTTTGACGGTCCCAAACACACATTTCACTGACTCCAAGTGAATTTACATGTTAATTTAATACATTGTTAAAGAAATAGTATGTTGTTGTTAAATAACTTAGTCATTGAATGTCTAAAGGGCATCATAAATTAAAATGTAAACAAAATAACTGCCCACGTGAAGAAAATACCATGGTATTTTACTGTAAATAGTGTTTTTAACCATACATAGTAAAGTATGTATTACTGATATATTGTTTAGAACTCTTTGTTGACATTAGTATGATGCAGCATACTATTGTCGATTATACCTAATAAATAGTAGTATACTTGAGATTTACTACAGTAAACTGTGCTGTTACAGTAGTTGAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7011
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042663 Nonsense 272 489 9 13
Genomic Location (Zv9):
Chromosome 5 (position 62717498)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 70505080
GRCz11 4 72024474
KASP Assay ID:
554-4832.1 (used for ordering genotyping assays)
KASP Sequence:
TCGAATACGAGTGTGAGGTTGAGCAGATTTACACCCAGCAGGARCTTCTG[C/T]AGTCCGARCACRGCACAAAGACRGCTGAATTAGGTAAATTMACAAACACA
Long Flanking Sequence:
TTTCCCTCTAGTTTAGCTTTCCCTCTAGTTTAGCTTTCCCTTTCGTTTAGCTTTCCCTCTAGTTTAGCTTTCCCTCTAGTTTAGCTTTCCCTCTAGTTTAGCTTTCCCTCTCGTTTAGCTTTCTCTCTTGTTTAGCTTTCCTTCTCGTTTAGCTTTCCCTCTCGTTGTCCTTTGCCTGTCATTTAGCTTTTTTTTTTTTATTTATCTAAATTTTTTTTGTTGTTTATGTTTCCCAGCAGGCCACAGTGGGTCTTCATCCGAGCTCGGCAGTGCCCTCGGCCCAGACTGGCATGAGGGCATTGAACTAAGAGGAGCAAAGCAGGTCTGTATACAGCACATGTTTGCATTTATACACTAACCAGCTTACTTACAATGATTCAAAAAGATCTCTTTCCACTGCATTTTTTTCATACTCCTCCATCATTTCTCAGAGCGTCCGTGGCATTCATATCGAATACGAGTGTGAGGTTGAGCAGATTTACACCCAGCAGGAGCTTCTG[C/T]AGTCCGAGCACAGCACAAAGACGGCTGAATTAGGTAAATTAACAAACACAGCCTGAAAATAATTCGTTCAGCTTAATAATAGAACCTAAATGTTTGTTTGTTTGTTGTTGTTTACAGGCGTGTGGCCAGCTTATGTGCAGTTGACCAATGGGAAGATTTATGGCTGTGATTTTATTGTCAGCGCAACAGGCGTCGTACCAAACACTGATCCGTTTCTTCCTGGCAACAATGTAAACATGCATCTGAATCCATACGTTTAGTTATAAACGTGTATTTATGTGTTGATTAAATAATCGTAATAAATCAAAGTCATTAATATTTAACAATATTTATATTTGTCAATTTAATATTTACTTACTATTGGATTTTGTTGATAACATTTATAAAATTATGTGTTTAATTATTTTTTATATTTAAAAACGGTTCTTTGAAACCATATTTTTATTTAAAAAAATAATGTTTATCATTATCATTATTATTAATTATTATTATCATTTTAA
Associated Phenotype:
Not determined