Busch Lab

ZMP

nxph1

Ensembl ID:
ENSDARG00000033447
ZFIN ID:
ZDB-GENE-040718-231
Description:
neurexophilin-1 [Source:RefSeq peptide;Acc:NP_001002733]
Human Orthologue:
NXPH1
Human Description:
neurexophilin 1 [Source:HGNC Symbol;Acc:20693]
Mouse Orthologue:
Nxph1
Mouse Description:
neurexophilin 1 Gene [Source:MGI Symbol;Acc:MGI:107492]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4058
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042276 Essential Splice Site 18 272 1 2
ENSDART00000148348 None None 252 None 1
Genomic Location (Zv9):
Chromosome 19 (position 39407216)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 38271199
GRCz11 19 37858319
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCGACGTGTTGGTGTGCCGTGTTTCTCATCACTCCGGCGGTCTACCTGG[T/G]AAGTGTTTCTTTTTTTANNCTCTCTCTCTCATCTTTTGCATCTCGTTTTGCT
Long Flanking Sequence:
TCTCTAATCTCCCCCTTCATGCTCTCCTGTCGTCCCTCCCATCCGCGCGCCTCTCCGGATGTAGTAGCGCGCGCGTGGCTCTCAGCGCGCGATATAAAGCCTCCGCTGAGTGACAGCGCGCGCCTGAAAAGCCTCTGTCCTTGTTTCTAAGAGGACTTACGCCGCAGTCACTCCAGGCAGAAAGACCAGCGAGCATCTCCCATGACATCTTAATGAAATATGACTGTGCTTCACTCCTTCACTGGATTAATGCCTATTTAAGCGTGCATTCGCGCTCTCCCTCCCTTATCTGTGTCCAAGTTTAAAGCCTATTCTGTGGTCATGGGGTCTATAATGTCATTTTTGCCTAGGCTAAAGGTCTAAAGCGGATACCAAGTGGATCTATGTTCCTTACAGACAAAAGAAACAGCGCAGGGAAATTAGTGGAAGTTTGAGAGAAGGGAGGATGCGGGCGACGTGTTGGTGTGCCGTGTTTCTCATCACTCCGGCGGTCTACCTGG[T/G]AAGTGTTTCTTTTTTTACTCTCTCTCTCATCTTTTGCATCTCGTTTTGCTACCTCACTTACATCTTTTGTTTACCCTGTAGAAAAAAACTCGTGTCTGGTAATGTATGCGGTGCTATGGTTTTAGTGTTAAAAAAAAACTTGTACGTCTTCATTTGTGTGACGTAGAAACGCTTTAATGCGTTAGTTTGGGAGTTGTTTTTGAAAATAAGTTTAAAAGCTCTCTAAATCATCTGATTTTATTTCTAAAAGCGAGTCCTGTGCTGACAAAACATTGTTTCTGTTGGTTTTGCGAGTTGCGCTTCTGTTTTTGTCCTCACGGGGGCGCCAAAAGAAATGAAAATAGCGGCGTGAATAAACCAGCAGTGACAGTTCTGCACCCCGAGGAGAGTCTCTTTGATTTCCACTGTTCAATACACACTCAAACCACATCTACAACTAACTACATTTTGCAAATTGCCTAATCACTTTATTGACAAAGAATTAGGACAGGATTGCTAGA
Associated Phenotype:
Not determined