Busch Lab

ZMP

zgc:136354

Ensembl ID:
ENSDARG00000033444
ZFIN ID:
ZDB-GENE-060512-339
Description:
mitogen-activated protein kinase kinase kinase kinase 2 [Source:RefSeq peptide;Acc:NP_001038725]
Human Orthologue:
MAP4K2
Human Description:
mitogen-activated protein kinase kinase kinase kinase 2 [Source:HGNC Symbol;Acc:6864]
Mouse Orthologue:
Map4k2
Mouse Description:
mitogen-activated protein kinase kinase kinase kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1346883]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa9330 Nonsense Mutation detected in F1 DNA Not yet available
sa19265 Nonsense Mutation detected in F1 DNA Not yet available
sa45743 Nonsense Mutation detected in F1 DNA Not yet available
sa16426 Essential Splice Site Available for shipment Available now
sa16484 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9330
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100351 Nonsense 97 889 4 32
ENSDART00000100351 Nonsense 97 889 4 32
Genomic Location (Zv9):
Chromosome 21 (position 33005649)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34005342
GRCz11 21 34039832
KASP Assay ID:
2261-5856.1 (used for ordering genotyping assays)
KASP Sequence:
TAGAAATAACAAGTTATGGATCTGCATGGAATTCTGTGGAGGAGGGTCAT[T/A]GCAAGATATTTACCATGGTATAGAATTCAGCAATTTGCTTAATTTTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19265
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100351 Nonsense 97 889 4 32
ENSDART00000100351 Nonsense 97 889 4 32
Genomic Location (Zv9):
Chromosome 21 (position 33005649)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34005342
GRCz11 21 34039832
KASP Assay ID:
2261-5856.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGAAATAACAAGTTATGGATCTGCATGGAATTCTGTGGAGGAGGGTCAT[T/A]GCAAGATATTTACCATGGTATAGAATTCAGCAATTTGCTTAATTTTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45743
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100351 Nonsense 399 889 18 32
Genomic Location (Zv9):
Chromosome 21 (position 33023304)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34022997
GRCz11 21 34057487
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTTGTGTCCGTAATATCAACAGCACTCACCAAATGAAGAGGATAAATA[T/A]GGGACTGTGAAGAGGATGGCCTCTTCTCCCCAATCAACAGCCCTCTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16426
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100351 Essential Splice Site 524 889 20 32
ENSDART00000100351 Essential Splice Site 524 889 20 32
Genomic Location (Zv9):
Chromosome 21 (position 33024883)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34024576
GRCz11 21 34059066
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAATCATTACCAAACTTTAATCAGTCTCTCRCAATTTATTACTTATAAAA[G/T]AAAGCTGTTGTCMATGGACTGCCACCTAMACCACAAGTACATGTAAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16484
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100351 Essential Splice Site 524 889 20 32
ENSDART00000100351 Essential Splice Site 524 889 20 32
Genomic Location (Zv9):
Chromosome 21 (position 33024883)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34024576
GRCz11 21 34059066
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAATCATTACCAAACTTTAATCAGTCTCTCRCAATTTATTACTTATAAAA[G/T]AAAGCTGTTGTCMATGGACTGCCACCTAMACCACAAGTACATGTAAGTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29634
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100351 Nonsense 741 889 27 32
Genomic Location (Zv9):
Chromosome 21 (position 33033126)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34032819
GRCz11 21 34067309
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTACAGGAAACTAAGGAGCTGCCACAGGTCTGTGTCGGGGTGAGAAGTTA[T/A]CCCAACCAAAAAGACACCTCTGGAGAGATGCACTTTGACATCATCCACCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4160
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100351 Essential Splice Site 790 889 29 32
Genomic Location (Zv9):
Chromosome 21 (position 33037670)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34037363
GRCz11 21 34071853
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCAGCTCTGTTTTTGTGTRTTTTTACAATCCAAGAAACCTTTTTGTTTC[A/C]GACATCGTGAAGGTTGTTAATTTGCAGGCATGCATGAGCCAACAGAAGAC
Associated Phenotype:
Not determined