Busch Lab

ZMP

asl

Ensembl ID:
ENSDARG00000033361
ZFIN ID:
ZDB-GENE-040426-1152
Description:
argininosuccinate lyase [Source:RefSeq peptide;Acc:NP_956745]
Human Orthologues:
AC068533.7, ASL
Human Description:
argininosuccinate lyase [Source:HGNC Symbol;Acc:746]
Mouse Orthologue:
Asl
Mouse Description:
argininosuccinate lyase Gene [Source:MGI Symbol;Acc:MGI:88084]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa13022 Essential Splice Site Available for shipment Available now
sa12812 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19263
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040190 Essential Splice Site 5 465 None 16
ENSDART00000132317 Essential Splice Site 5 240 None 10
ENSDART00000040190 Essential Splice Site 5 465 None 16
ENSDART00000132317 Essential Splice Site 5 240 None 10
Genomic Location (Zv9):
Chromosome 21 (position 30016422)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31216673
GRCz11 21 31253368
KASP Assay ID:
2261-5816.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGCACGTAGGTCGCTACTCTAGAGACTGTTACAATGGCAAGTTCAGAGG[T/G]AAATATAGCTATTTAATTTCTGATTTTGCATGTGTTTCATAGTTACAAGC
Long Flanking Sequence:
TGCCACCTTGCTGTGAGGCGACAGTGCTTTCCACTGAGCCACCATGTCGCCCCATTAAAGCATTATCTTTCATTTTAATTAGACAATGACGCCATCCATCGTCCATGACCGTCACTGCAGGCTGATTTATAAAAATGTATTTTCCTTTAGAGAGGCGGTTCTGTATCCTTCGGTATAGTTGACGGGATTGGTTACTCAAATGAACGACAGCTCCCGAAAAATCGCGCTTATGATTTTGATTAGTTCACAAACACCTCATTTGCATATTATGGGCGGGGCGTGCTTGGTCCCAAAATAAACGAGGAGGAAATGCAGTCCGGTCGCTGTTGGATGTTCAGGCTCTTACTGTAATTTATCTCACGAATACTTAAAAGCACTGATTTGTTCCTTTAATTATTTGACATTTCCTCATTCTGTTTGAATCATACGCTTTAGTTTTCCGCTTGCTCATCGCACGTAGGTCGCTACTCTAGAGACTGTTACAATGGCAAGTTCAGAGG[T/G]AAATATAGCTATTTAATTTCTGATTTTGCATGTGTTTCATAGTTACAAGCCTTTTAAGAAAAGTCCTAATGTCTATTTTATGACAGGGAAATAAACTATGGGGTGGTCGCTTTGTGGGAAACACCGACCCTATAATGGAAAAGTTCAACGCGTCAATCTCGTACGACCAGCGAATGTGGAAAGCTGATATTAAAGGGAGTAAAGCTTATGTAAAAGCTTTACAGAAAGCAAGCCTTGTAACCCAAAACGAGATGGAACAGATTCTTACAGGCCTTGACAAGGTGATAACATTTTATTCACCACGTTACCTCAACTACAAACCAGTTTGGTTGCTTACTTTCAGGTTATATGTGTTTGTGTGTGTGTTTTGTTTTTGCAATGTCAGTTTCTTTTTGAAACTTTAGCCTATATGATGCTCCTTGGTAAATATTCACCTGGGTACTGTACCACAGTCCATTTCACCCTTTGGCACCAACGCTTAATGCATAACAGACAAAAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7965
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040190 Essential Splice Site 5 465 None 16
ENSDART00000132317 Essential Splice Site 5 240 None 10
ENSDART00000040190 Essential Splice Site 5 465 None 16
ENSDART00000132317 Essential Splice Site 5 240 None 10
Genomic Location (Zv9):
Chromosome 21 (position 30016422)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31216673
GRCz11 21 31253368
KASP Assay ID:
2261-5816.1 (used for ordering genotyping assays)
KASP Sequence:
TCGCACGTAGGTCGCTACTCTAGAGACTGTTACAATGGCAAGTTCAGAGG[T/G]AAATATAGCTATTTAATTTCTGATTTTGCAYGTGTTTCATAGTTACAAGC
Long Flanking Sequence:
TGCCACCTTGCTGTGAGGCGACAGTGCTTTCCACTGAGCCACCATGTCGCCCCATTAAAGCATTATCTTTCATTTTAATTAGACAATGACGCCATCCATCGTCCATGACCGTCACTGCAGGCTGATTTATAAAAATGTATTTTCCTTTAGAGAGGCGGTTCTGTATCCTTCGGTATAGTTGACGGGATTGGTTACTCAAATGAACGACAGCTCCCGAAAAATCGCGCTTATGATTTTGATTAGTTCACAAACACCTCATTTGCATATTATGGGCGGGGCGTGCTTGGTCCCAAAATAAACGAGGAGGAAATGCAGTCCGGTCGCTGTTGGATGTTCAGGCTCTTACTGTAATTTATCTCACGAATACTTAAAAGCACTGATTTGTTCCTTTAATTATTTGACATTTCCTCATTCTGTTTGAATCATACGCTTTAGTTTTCCGCTTGCTCATCGCACGTAGGTCGCTACTCTAGAGACTGTTACAATGGCAAGTTCAGAGG[T/G]AAATATAGCTATTTAATTTCTGATTTTGCATGTGTTTCATAGTTACAAGCCTTTTAAGAAAAGTCCTAATGTCTATTTTATGACAGGGAAATAAACTATGGGGTGGTCGCTTTGTGGGAAACACCGACCCTATAATGGAAAAGTTCAACGCGTCAATCTCGTACGACCAGCGAATGTGGAAAGCTGATATTAAAGGGAGTAAAGCTTATGTAAAAGCTTTACAGAAAGCAAGCCTTGTAACCCAAAACGAGATGGAACAGATTCTTACAGGCCTTGACAAGGTGATAACATTTTATTCACCACGTTACCTCAACTACAAACCAGTTTGGTTGCTTACTTTCAGGTTATATGTGTTTGTGTGTGTGTTTTGTTTTTGCAATGTCAGTTTCTTTTTGAAACTTTAGCCTATATGATGCTCCTTGGTAAATATTCACCTGGGTACTGTACCACAGTCCATTTCACCCTTTGGCACCAACGCTTAATGCATAACAGACAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13022
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040190 Essential Splice Site 117 465 4 16
ENSDART00000132317 Essential Splice Site 117 240 5 10
ENSDART00000040190 Essential Splice Site 117 465 4 16
ENSDART00000132317 Essential Splice Site 117 240 5 10
Genomic Location (Zv9):
Chromosome 21 (position 30020980)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31221231
GRCz11 21 31257926
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGTGATGCTGCTGGAAAGCTTCATACTGGCAGGAGCAGAAATGATCAGG[T/G]TCCTCCAATTGTAATTTCAGTTTTGCTGTTATWTCGCATGACAYTTAATT
Long Flanking Sequence:
AGACTTATCTTTTTTTACAGATGAATTTACCACCAGTTGACCTGAAACCGATTGAAAGTGTTTGAGTTGTCCTGTGAAGTAGACCCTGGACACCACAGGGTCTGATAATGGGAATGCTCAACTTCTCATTACAAGCCATGAGTGAAAAAATACATGCAACCCTAGATGGAAATACAATGTGTGAAATTGCATAAAAGATCTTCATTATCTGACCCTGAGGAGATCCACTCTGTGAAGTCTGTTCCAGCACGTCACAAAGACTTTCGATGGTGTTCAGATCAATTGATAATCAATTCATGTGTCAAAATGAAACCTCTTTTCATAGTTTGAGTCTAATTTGCATTGCCATCTTAGAGTCTTCTAAAGAAATAAAAGCTCCACACAGCCTCATTTAGAGTTGCTTAAAATGAGTCAATGTTAATCTCATCTCTCTTTTTTAAAGGAATTGATTGGTGATGCTGCTGGAAAGCTTCATACTGGCAGGAGCAGAAATGATCAGG[T/G]TCCTCCAATTGTAATTTCAGTTTTGCTGTTATATCGCATGACATTTAATTAACTTGCATATTATTTGGCTCACTTGTCGGATAGGTTGCAACTGATATGCGACTCTGGTTACGGGATGGTATTGCCACGCTTAAAGAACTGGCTTTGCAACTCATCAACACTATGGTGGAAAGAGCTGCAGCGTAAGAATATGCACAGTAATCTTAATACATTTATTAATAAGAGTAATGTACTATTGCCAAATACATAGCTATTTTTTTTAATCCTTTTAGAGAGATTGAAATCCTGTGCCCAGGATACACTCACATGCAGAGAGCCCAGCCAATCAGATGGAGTCACTGGCTTCTCAGGTGTATTTCTATTTTAGATTTAAAGTGACTTTTCACACAGAAATGAACTTTTAATCACACTCAAGTGGTTCTAAAAAAATTACGAATTTCTTTTTTCACTTGTAAAGCATAAAAAAATATAAATTCTGAAGAATGTTGAAAACTAGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12812
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040190 Essential Splice Site 117 465 4 16
ENSDART00000132317 Essential Splice Site 117 240 5 10
ENSDART00000040190 Essential Splice Site 117 465 4 16
ENSDART00000132317 Essential Splice Site 117 240 5 10
Genomic Location (Zv9):
Chromosome 21 (position 30020980)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31221231
GRCz11 21 31257926
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGTGATGCTGCTGGAAAGCTTCATACTGGCAGGAGCAGAAATGATCAGG[T/G]TCCTCCAATTGTAATTTCAGTTTTGCTGTTATWTCGCATGACAYTTAATT
Long Flanking Sequence:
AGACTTATCTTTTTTTACAGATGAATTTACCACCAGTTGACCTGAAACCGATTGAAAGTGTTTGAGTTGTCCTGTGAAGTAGACCCTGGACACCACAGGGTCTGATAATGGGAATGCTCAACTTCTCATTACAAGCCATGAGTGAAAAAATACATGCAACCCTAGATGGAAATACAATGTGTGAAATTGCATAAAAGATCTTCATTATCTGACCCTGAGGAGATCCACTCTGTGAAGTCTGTTCCAGCACGTCACAAAGACTTTCGATGGTGTTCAGATCAATTGATAATCAATTCATGTGTCAAAATGAAACCTCTTTTCATAGTTTGAGTCTAATTTGCATTGCCATCTTAGAGTCTTCTAAAGAAATAAAAGCTCCACACAGCCTCATTTAGAGTTGCTTAAAATGAGTCAATGTTAATCTCATCTCTCTTTTTTAAAGGAATTGATTGGTGATGCTGCTGGAAAGCTTCATACTGGCAGGAGCAGAAATGATCAGG[T/G]TCCTCCAATTGTAATTTCAGTTTTGCTGTTATATCGCATGACATTTAATTAACTTGCATATTATTTGGCTCACTTGTCGGATAGGTTGCAACTGATATGCGACTCTGGTTACGGGATGGTATTGCCACGCTTAAAGAACTGGCTTTGCAACTCATCAACACTATGGTGGAAAGAGCTGCAGCGTAAGAATATGCACAGTAATCTTAATACATTTATTAATAAGAGTAATGTACTATTGCCAAATACATAGCTATTTTTTTTAATCCTTTTAGAGAGATTGAAATCCTGTGCCCAGGATACACTCACATGCAGAGAGCCCAGCCAATCAGATGGAGTCACTGGCTTCTCAGGTGTATTTCTATTTTAGATTTAAAGTGACTTTTCACACAGAAATGAACTTTTAATCACACTCAAGTGGTTCTAAAAAAATTACGAATTTCTTTTTTCACTTGTAAAGCATAAAAAAATATAAATTCTGAAGAATGTTGAAAACTAGCTGC
Associated Phenotype:
Not determined