Busch Lab

ZMP

unc5b

Ensembl ID:
ENSDARG00000033327
ZFIN ID:
ZDB-GENE-041213-1
Description:
unc-5 homolog B [Source:RefSeq peptide;Acc:NP_001104619]
Human Orthologue:
UNC5B
Human Description:
unc-5 homolog B (C. elegans) [Source:HGNC Symbol;Acc:12568]
Mouse Orthologue:
Unc5b
Mouse Description:
unc-5 homolog B (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:894703]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa9232 Nonsense Mutation detected in F1 DNA Not yet available
sa35510 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1 Nonsense Available for shipment Available now
sa13358 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9232
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045951 Nonsense 94 911 2 16
ENSDART00000109546 Nonsense 123 940 3 17
Genomic Location (Zv9):
Chromosome 13 (position 29419602)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29065550
GRCz11 13 29196000
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTAGTGAGAGAAGTAGATATCTCTRTCTCCCGGACGCAGGTAGAGGAGT[T/A]GTTTGGGCTGGARGATTATTGGTGCCAGTGTGTTGCCWGGAGCTCGGCAG
Long Flanking Sequence:
AGAACTTAAACCAACTGAGTACTGAAAACCCAATAAGTTAAGGCAACTCAAACCGTTTAAGGAAACTGATTGCTGCAAACCATTTGAGTAAAAAAAAATGGATCTATATGAGTACTGTGAACTTAATCCATTTAAGTTGAAGTAATGAGGTATTTAATTTCTCTGAGTTCAAAACTCTTTTCAAATGAGTAGAATTAACTTTTAGTAAAATATGAGTTACCTACACTTATTTCATTTGATAAAGTTGACTGTTGGGTTTTACAGTATAATTTTGTTTTAAATGTATTATTATTAAATCTCCAAAATGCATCAATATAAACACAAGTGTATTATTTTTAAACAAAACAGTGTTGCAATTTCCCTTCCTCTGTCAGGATGTATAGTGACACAAATTTGAAAGCTGAGACTGATATATTCATACTTTCCTCTTTTGTTCTCTGTCTCAGGTCTGGTAGTGAGAGAAGTAGATATCTCTGTCTCCCGGACGCAGGTAGAGGAGT[T/A]GTTTGGGCTGGAGGATTATTGGTGCCAGTGTGTTGCCTGGAGCTCGGCAGGCACCACAAAGAGCCGTCGGGCTTACGTCCGCATCGCCTGTGAGTTTGTGTTCAGCAGCTTATGTGATCTGTCGGTGTGACGTGCCTTTTAGGCATCAAACTCTGCCTGGAGATGACAGCACCTGAAGAGAACCCTAGTATTTTGAATTTAAAACACTCCCTATTTTTACTTGTGCTATTTTAATCCAGAACACATGAATACATATTTCCATATAATTAAAAAATGGAAACCCTTTTTGGTTGTTTTGGATTTCAAAAAATATGATCTGTTTGTTTTTTTCAGACTTGAGAAAGAACTTTGAGCAGGAGCCGCTTGGCAGGGAGGTGCGTCTGGAGCAGGAAGTATTACTGCAGTGTCGTCCACCAGAGGGCAGCCCGCCTGCTGAGGTGCTGTATTGTCTTCCTATGCTTTTTGCATATTTTACAGTCTATGATATAGAGGTGGATTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28124
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045951 Nonsense 188 911 4 16
ENSDART00000109546 Nonsense 217 940 5 17
Genomic Location (Zv9):
Chromosome 13 (position 29422575)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29068523
GRCz11 13 29198973
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTGGATTCTAACTTTCTAATTACCATCGAGCACGACCTGATCATCAAA[C/T]AGGCTCGACTCTCTGACACTGCCAACTACACCTGTGTGGCACGTAATGTG
Long Flanking Sequence:
TAACGAGCAGTTGGACAAGTGTACCTAATAATGTGGCCAGTGAGTGTAAAAAGGATACATTCTCCCCAAAGGATACATCTCCATCCATATCATGTAATTGTGCAAATGTTTTTTTTGACCCTGGATTAAATTTTCAATTATATTTTAGGATGCAAAGGTTAAAATTACATCAAATTTAAATATATTTAAAATGTGTAAAGATATTTAATTGTTCCTCACATTTATTTATATTTGAAATAAATATTGCCATAAATTATTTTATTTTATTTTATTTACCATATGGTGGAAAACATCTTTTAGAGCACGTCTGGTGCTTTTTAATGTTCTATTAAAATAATTTAAAGTGCAGTTTTGGTCCAGATGCACATCGTTGTTCTTGTAACTTTATGCATTGATTTTTTGTAATGTCACAGGTGGACTGGCTAAAGAACGAAGAGCTCATTGACCCGGCGCTGGATTCTAACTTTCTAATTACCATCGAGCACGACCTGATCATCAAA[C/T]AGGCTCGACTCTCTGACACTGCCAACTACACCTGTGTGGCACGTAATGTGGTCGCTAAGAGACGCAGCAGCACTGCCACTCTCATCGTCTACGGTAACCACTTGACCAATTGCAGTCCCTGCATCAGTCTGAGTCACTGAGTGCACAAGTCAAGGGCTAATTCGGAAAACAGGAGAACTACAATCACCACTCGAGTTTATGAATATTTATAACATGGCTATCTGAAATACTCGCTACTTATTGGTCAGCTCTGGTATTCGACAGTCTGTAATGGTTGTTGTATTAATATATGACTATTTGCCTACTTGTGCTTATATAAATATACACTCACAGAGTTGAAATTGAAACTGATGTTAAATTGTAGTTCTTTTTCAGATATTTCCAAGTGATTTTTAACATATCAAGGAGATTTTTATCAGAATTTTCTTTAATATTATTATATATTTAGTGAGTATTTCCTATAAATAAATTAAGACTTTAAATTGCACTTTAAGCTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35510
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045951 Essential Splice Site 219 911 4 16
ENSDART00000109546 Essential Splice Site 248 940 5 17
Genomic Location (Zv9):
Chromosome 13 (position 29422670)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29068618
GRCz11 13 29199068
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGTGGTCGCTAAGAGACGCAGCAGCACTGCCACTCTCATCGTCTACGG[T/C]AACCACTTGACCAATTGCAGTCCCTGCATCAGTCTGAGTCACTGAGTGCA
Long Flanking Sequence:
AATTGTGCAAATGTTTTTTTTGACCCTGGATTAAATTTTCAATTATATTTTAGGATGCAAAGGTTAAAATTACATCAAATTTAAATATATTTAAAATGTGTAAAGATATTTAATTGTTCCTCACATTTATTTATATTTGAAATAAATATTGCCATAAATTATTTTATTTTATTTTATTTACCATATGGTGGAAAACATCTTTTAGAGCACGTCTGGTGCTTTTTAATGTTCTATTAAAATAATTTAAAGTGCAGTTTTGGTCCAGATGCACATCGTTGTTCTTGTAACTTTATGCATTGATTTTTTGTAATGTCACAGGTGGACTGGCTAAAGAACGAAGAGCTCATTGACCCGGCGCTGGATTCTAACTTTCTAATTACCATCGAGCACGACCTGATCATCAAACAGGCTCGACTCTCTGACACTGCCAACTACACCTGTGTGGCACGTAATGTGGTCGCTAAGAGACGCAGCAGCACTGCCACTCTCATCGTCTACGG[T/C]AACCACTTGACCAATTGCAGTCCCTGCATCAGTCTGAGTCACTGAGTGCACAAGTCAAGGGCTAATTCGGAAAACAGGAGAACTACAATCACCACTCGAGTTTATGAATATTTATAACATGGCTATCTGAAATACTCGCTACTTATTGGTCAGCTCTGGTATTCGACAGTCTGTAATGGTTGTTGTATTAATATATGACTATTTGCCTACTTGTGCTTATATAAATATACACTCACAGAGTTGAAATTGAAACTGATGTTAAATTGTAGTTCTTTTTCAGATATTTCCAAGTGATTTTTAACATATCAAGGAGATTTTTATCAGAATTTTCTTTAATATTATTATATATTTAGTGAGTATTTCCTATAAATAAATTAAGACTTTAAATTGCACTTTAAGCTGAATACTAGTATCTTGCAAATGACTTATAAAACGTTATCTACTGACTCTTAGAAAATATTTGAATATTTTATTTTATTTTATTTTTTTGTATTTAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045951 Nonsense 232 911 5 16
ENSDART00000109546 Nonsense 261 940 6 17
Genomic Location (Zv9):
Chromosome 13 (position 29424359)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29070307
GRCz11 13 29200757
KASP Assay ID:
554-0142.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTTATTAGTAAGTGGAGGCTGGTCATCCTGGACAGAGTGGTCAGAATG[T/A]AATGCTCAGTGTGGGCGGGGCTGGCAGAGACGGACACGCAGCTGCACCAA
Long Flanking Sequence:
GACCAACAGTATGATATCCCTCAATTAATGCACAACGTGTTTACTTTTGTATTCAGACTTGTGTTAAATTTTTATTCTTTCATTTTTCATTGACTGTTTCAAACATGCTCCATTCTATTCTAATTAAACTGCATGCCAATGTAAACATATCTGATTAATATCTGATCCTGTATTAATAATATGTGTCTCTGGCTGTCTGGTATTAGTAAAAATCCTTCAAATATGACACAAAGGGGTTACTTTTGCATGCTTGCTTGTATTTGTTTTTTATTTTTCTCATTTTCCAAACACTATTTCAAACATTCTCCCTTCTCGTCAGATCTCATCGATTGCCTAAATTCACTGAGAAATGGATAAAAATATTCATTTTCAAAATGGGGTGTACTCAATTATACTGAGCACTGTACACATTCTTGATAAGCTGTATTAATAGTATTTGTCTCTGGCTCTCTGTTATTAGTAAGTGGAGGCTGGTCATCCTGGACAGAGTGGTCAGAATG[T/A]AATGCTCAGTGTGGGCGGGGCTGGCAGAGACGGACACGCAGCTGCACCAATCCAGCACCACTCAATGGAGGAGCCTTCTGTGATGGACCGCCCTTCCAGAGAGTCACCTGTACCACCCTCTGTCCAGGTAAACGCTCAACACAAATTCACCCCTGTAACCTTTGACCTGAGCCACTGTGTAATCACTGATGTGTTTTCCTAGTGGATGGAGGCTGGACCGAGTGGGCCAAGTGGTCTGCGTGTGGGACGGAGTGCACACATTGGCGCAGTCGTGAATGTCAGGCTCCACCGCCACGTAATGGAGGACGACACTGCAGCGGCAGCATGATGGAGAGCAAGAACTGCACTGAGGGATTATGTGCACGCAGTAAGTCATGTGATTCAGCATCATCAGTGGGAAAATGTCTTGGAATGTTGGTCTGGATATCATATTAACAAGTGGCAGATATGGAACTGGTCCACACTGGGGTTATTGCTGACTGTCAGCAAAATGTCAATAT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa13358
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045951 Nonsense 627 911 12 16
ENSDART00000109546 Nonsense 656 940 13 17
Genomic Location (Zv9):
Chromosome 13 (position 29440311)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29086259
GRCz11 13 29216709
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACTAGGAGGTGCTGACTGTGGGAGAGGAGAGTCTRTCGTCACCCTGTTA[T/A]CTGCAGGTGGAGGAGCAGAGTTGTCATATCCTSATGGAGCAGCTGGGCAC
Long Flanking Sequence:
AGTCTGTTTCACTAGTAAATATCTCTTTATTCTTTAGATTTGCTCCTTTTTTTTTTTAAATTGTTTGGTATAATCTAATTACACAAGTTAGCAAAATAAATAACCCAGTTCTAGTGCCTAGTGTAGAACCAGTTAATTGTTTATTTTAACAATATTTTTATTGTAAGTACATGTCAAATGCTTTAACAAGACATTTACATTTGTGTTTTTTGCTGTGCTTTGTTACTCTTTGGAGCTGTTCATATGAATGATTATAGCATGTGAACATTGCCAATCGAGCAGCGTTTAGTTACCTTTTAAGGCACAAACAATATATTGAATATTTATCAAACACATGTCAAGGATTTATTGTAAGATTATATTGCAATGATTATCATTATTGTTTTACTGCCTAGCTTCACATAATTAACATTTGAACAGTATTGCTTTAACTCCTGTTTTCCTCCCATCCACTAGGAGGTGCTGACTGTGGGAGAGGAGAGTCTATCGTCACCCTGTTA[T/A]CTGCAGGTGGAGGAGCAGAGTTGTCATATCCTGATGGAGCAGCTGGGCACTTATGGGCTGGTGGGACAGTCGGCTCCTCCTCGGCCGGCCTGTAAGAGACTGCAGTTGGCCCTGTTTGCCCCTCGGGCCCCGTGCCTCTCTCTGGACTACAGTCTGAGGGTTTACTGCATACAGGACACCCCACATGCCCTCAAGGTTAGTCTGTCTTCCCTTCTTAACTAGCCATCTCATGTGTATTTGACCTGTGAATAAGCTATAATTCTGTGTTGTTGTTTTCTGCAGGAAGTATTAGAGGTTGAGAGAAGTCTGGGTGGGGTTTTACTGGAGGATCCCAAACCTTTGCTTTTTAAGGACAGTTACCACAATATGCGGCTGTCGATCCATGACATCCCTCATTCACACTGGAGGAGCAAACTCCTGGCTAAGTATCAGGTGAGAGACTTTATGCTGTTGTTGGTCATATGGTTATCCTTTTTTTAGTTAATTAACTTTTTATAATA
Associated Phenotype:
Not determined