Busch Lab

ZMP

si:ch211-273k1.4

Ensembl ID:
ENSDARG00000033259
ZFIN ID:
ZDB-GENE-070705-171
Human Orthologue:
DIS3L2
Human Description:
DIS3 mitotic control homolog (S. cerevisiae)-like 2 [Source:HGNC Symbol;Acc:28648]
Mouse Orthologue:
Dis3l2
Mouse Description:
DIS3 mitotic control homolog (S. cerevisiae)-like 2 Gene [Source:MGI Symbol;Acc:MGI:2442555]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa25753 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25753
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083272 Nonsense 703 995 13 20
ENSDART00000136180 Nonsense 333 625 7 14
ENSDART00000145517 None None 339 None 6
Genomic Location (Zv9):
Chromosome 2 (position 5515048)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5960776
GRCz11 2 5872658
KASP Assay ID:
2259-1544.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTTCACCCTTGATAAGGAGTCCAGCATGCCTCAGGGCTGTTACGTCTA[T/A]CAGTATCGAGACAGCAATAAGTAAGTATGCATACAATTGCTATCATACCA
Associated Phenotype:
Not determined