Busch Lab

ZMP

trappc6bl

Ensembl ID:
ENSDARG00000033171
ZFIN ID:
ZDB-GENE-040426-1602
Description:
trafficking protein particle complex 6b-like [Source:RefSeq peptide;Acc:NP_956955]
Human Orthologue:
TRAPPC6A
Human Description:
trafficking protein particle complex 6A [Source:HGNC Symbol;Acc:23069]
Mouse Orthologue:
Trappc6a
Mouse Description:
trafficking protein particle complex 6A Gene [Source:MGI Symbol;Acc:MGI:1914341]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa18603 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18603
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043492 Nonsense 83 161 4 7
ENSDART00000133080 Nonsense 83 102 4 5
ENSDART00000147796 None None 77 None 3

The following transcripts of ENSDARG00000033171 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 14113939)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14144987
GRCz11 15 14080944
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATAATGAAGTTCGTATGTAAAGACTTCTGGAGCACTMTCTTCAAAAAA[C/T]AAATCGACAACTTGAGGACCAACCATCAGGTCTCAATGTTCAGTACTATC
Associated Phenotype:
Not determined