Busch Lab

ZMP

nr1d1

Ensembl ID:
ENSDARG00000033160
ZFIN ID:
ZDB-GENE-050105-1
Description:
nuclear receptor subfamily 1 group D member 1 [Source:RefSeq peptide;Acc:NP_991292]
Human Orthologue:
NR1D1
Human Description:
nuclear receptor subfamily 1, group D, member 1 [Source:HGNC Symbol;Acc:7962]
Mouse Orthologue:
Nr1d1
Mouse Description:
nuclear receptor subfamily 1, group D, member 1 Gene [Source:MGI Symbol;Acc:MGI:2444210]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa19994 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19994
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040468 Nonsense 145 636 3 10
ENSDART00000126282 Nonsense 145 637 3 8
Genomic Location (Zv9):
Chromosome 3 (position 23784018)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23362229
GRCz11 3 23492777
KASP Assay ID:
2259-3379.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGTGTGTGGCGATGTGGCTTCTGGATTTCACTATGGCGTCCATGCCTG[T/A]GAGGGATGCAAGGTAAGAATGAGCAATTGATTAGCATGTATATGCACCAT
Long Flanking Sequence:
TGTTGTAAATATACCTCTTCTTTCACCACCAGGTGGGGTGATATCATACATTGGATCATGTGGAGGCTCTCCCAACCGTACCAGCCCTGTGTCCATGTACAGTGAGAATTCCAACAGCAGCATGCAGTCCCTTACACAACCCTGCTTCGGATCATCATTCCCACCATCCCCTAATGGATCTCATGATTCCTCACGGATGTACACCAGTAGCAGCAGCAGCTCGAGTTCAGGATCAGGAGAGGACGGAAACTCATCATGCTCTGGTGGATCACCGAGAGGCCGTGATGATGGTGGAAGCGCACGCAATTCACCCAACAAATCAGTTGCCACCCTTACTAGTAAGTGATAAGAAGCAGAGATTACCTGATTAACGTTGAGTACAATGTCCAGAAGCACGATTATAACATCTGACTTTCTCATCCAGAGCTGAATGGAATGGTGTTGCTGTGCAAGGTGTGTGGCGATGTGGCTTCTGGATTTCACTATGGCGTCCATGCCTG[T/A]GAGGGATGCAAGGTAAGAATGAGCAATTGATTAGCATGTATATGCACCATTAAAATAGTGACTCTAATTAAAATATATATATATTTACATGATCTTTGTGTTCCACAGGGTTTCTTTCGACGCAGCATCCAGCAGAACATCCAGTACAAAAAGTGCCTCAAGAATGAAACTTGTACCATTATGCGGATCAACCGGAATCGGTGCCAGCAGTGCCGTTTCAAAAAGTGTCTGTCAGTGGGCATGTCCCGAGATGGTACGTATTAAAAAGCAACTCCACTCCACTGTCATTTTTATTGTTTTTGTTATTTAGAGGAAATCATGTAGCAAATTCATTTAAACAAATGGTCTCAAACTCAATTCCTGGAGGGCCACAGCTCTACATAGCTCCAACCACATCCAAATCACACCTGCTTAATAGTCTCTAGTAGTCTTGAACACCTTGATTAGTTGGATCAGCTGTGTTTGATAAAAGCTGGAGCAAAACTGTTCAGAGCTGCGGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3431
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040468 Nonsense 153 636 4 10
ENSDART00000126282 Nonsense 153 637 4 8
Genomic Location (Zv9):
Chromosome 3 (position 23784136)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23362347
GRCz11 3 23492895
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAAANNATATATATATATTTACATGATCTTTGTGTTCCACAGGGTTTCTTT[C/T]GACGCAGCATCCAGCAGAACATCCAGTACAAAAAGTGCCTCAAGAATGAA
Long Flanking Sequence:
AGCATGCAGTCCCTTACACAACCCTGCTTCGGATCATCATTCCCACCATCCCCTAATGGATCTCATGATTCCTCACGGATGTACACCAGTAGCAGCAGCAGCTCGAGTTCAGGATCAGGAGAGGACGGAAACTCATCATGCTCTGGTGGATCACCGAGAGGCCGTGATGATGGTGGAAGCGCACGCAATTCACCCAACAAATCAGTTGCCACCCTTACTAGTAAGTGATAAGAAGCAGAGATTACCTGATTAACGTTGAGTACAATGTCCAGAAGCACGATTATAACATCTGACTTTCTCATCCAGAGCTGAATGGAATGGTGTTGCTGTGCAAGGTGTGTGGCGATGTGGCTTCTGGATTTCACTATGGCGTCCATGCCTGTGAGGGATGCAAGGTAAGAATGAGCAATTGATTAGCATGTATATGCACCATTAAAATAGTGACTCTAATTAAAATATATATATATTTACATGATCTTTGTGTTCCACAGGGTTTCTTT[C/T]GACGCAGCATCCAGCAGAACATCCAGTACAAAAAGTGCCTCAAGAATGAAACTTGTACCATTATGCGGATCAACCGGAATCGGTGCCAGCAGTGCCGTTTCAAAAAGTGTCTGTCAGTGGGCATGTCCCGAGATGGTACGTATTAAAAAGCAACTCCACTCCACTGTCATTTTTATTGTTTTTGTTATTTAGAGGAAATCATGTAGCAAATTCATTTAAACAAATGGTCTCAAACTCAATTCCTGGAGGGCCACAGCTCTACATAGCTCCAACCACATCCAAATCACACCTGCTTAATAGTCTCTAGTAGTCTTGAACACCTTGATTAGTTGGATCAGCTGTGTTTGATAAAAGCTGGAGCAAAACTGTTCAGAGCTGCGGCCCTCCAGGAATCCAGTTTGAGACCTATGATCTAAACATTGCTTTATTTTATATATCTGTAACACCTTTTACTTTAAGCAAAGAATGAAAAATAAGCATTGCCATTAGTGCACTGGAAC
Associated Phenotype:
Not determined