Busch Lab

ZMP

si:ch73-379f5.1

Ensembl ID:
ENSDARG00000033071
ZFIN ID:
ZDB-GENE-091113-36
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa19950 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25997
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031885 Nonsense 143 454 2 6
ENSDART00000142691 Nonsense 150 461 2 6
Genomic Location (Zv9):
Chromosome 3 (position 8875937)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8413404
GRCz11 3 8291146
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTATATATTGTTTAGGAGGAGTTCAATGCGGCAGTGACGTCCTTAAAGT[G/A]GAAACTTAAACGCAGGGAAAAAATGAAAGGACAGTTGGAGGAAACGCTTC
Long Flanking Sequence:
CCGTGTGCTGTGAAATCTTCAAGGATCCAGTTTTTCTGTCGTGCAGTCACAGTTTCTGTAAAAAGTGTCTTCAGCAGTACTGGAGTACCACGGAAACTGAAGAGTGTCCTGTTTGCCGGAGAAAATCCTCCAGAGATGATCCTCCAATTAATCTTGTGTTAAGAAACTTGTGTGAGTTGTTCCTGAAGGAGAAAAACGAGAGATGTTCATCGGTATCTGAGGAGATCTGCAGTTTACACGGTGAGAAACTCAAACTCTTCTGTCTGGAGGACAAACAGCCTTTGTGTGTGATGTGTGTCACTTTACAGCAACATGAGAATCACAAATTCAAGCCCATCGATGAAGCCATTCCAATGTGTAAGGTGAGACTGTTTCTTTATGTAAAGGACAAACAGATATCTCATCCATGTGTTTAAAATTTCTTTCTAAATAATAACTTTTAAGAGTGTTTTTATATATTGTTTAGGAGGAGTTCAATGCGGCAGTGACGTCCTTAAAGT[G/A]GAAACTTAAACGCAGGGAAAAAATGAAAGGACAGTTGGAGGAAACGCTTCAACACATCAAGGTGAGAAAACTCTTGATGATGTTGATGTTTCATTCATTTCATTTTCTTGTCGGCTTAGTCCCTTTATTAACCGGGGTCGCCACAGCGGAATGAACCGCCAACTTATCCAGCAAGTTTTTACGCAGCAGATGCACTTCCAGACGTAACCCATCTCTGGGAATAATGCACAAACACATTCACACACTCATACACTACGGACAATTTAGCCTACCCAATTCACCTGTACCGCATGTCTTTGGACTGTGGGGGAAACTGGAGCACCCGGAGGAAGTTGATGTTTCACTGAATGTTTACTTTGAAGTCACCACTGTGGTGATCAGCATCTTTTTCTCAGGCCCCGTTTACACTACTACATTTTTGTTTTAAAATGCATACGTTTTGCTACGGTTACGCCATCCATCCGCACTACGCCAGAGTTTTCAAAGCTTTTTGGAAACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19950
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031885 Essential Splice Site 248 454 5 6
ENSDART00000142691 Essential Splice Site 255 461 5 6
Genomic Location (Zv9):
Chromosome 3 (position 8880526)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8417993
GRCz11 3 8295735
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTCTCTCTGCTTCTGAATCCTGCAGTTCTGACTCCTGAATGTTCTTCC[A/T]GAGTCCAGATCTCACAGCCGGATCCACAGACGCCTTCTGGAGCTTTGATT
Long Flanking Sequence:
TCCTTTTTTTAGAGTGTATGTAGACTTCTGGTTTCAACTGTATCTACAAATTCTTGTTTTGAGAAATACATCAAAATTAAGTTAAGTTTGCTTTTAGACTCAAGCTGATCACACAGAGCGTCAGATTAAACATGAGTTTGAGAGGCTTCATCAGTTTCTCCGAGATGAAGAAGAAGCTACAATCACTGCACTGAGGGAGGAAGAGGAGCAGAAGAAGCAGATGATGAAGGAGAAGCTGGAGGAGATGAACACACACATCGCAGCTCTTTCACACACAATCAAAGACTCGGAGGAGATGCTGAAAGCCAATGACGTCTGCTTTCTAAAGGTCTGATTTCAGATCAGTGATTGATTGATTGATGATGGATTGAGCTCTTGATGATCAGTTGTGTGTTTGTTCTGCAGGAGTTTCCAGTCTCGATGGAAAGGTGAGTGATCTGCTGGTGTCTCTGCTCTCTCTGCTTCTGAATCCTGCAGTTCTGACTCCTGAATGTTCTTCC[A/T]GAGTCCAGATCTCACAGCCGGATCCACAGACGCCTTCTGGAGCTTTGATTAATGTGTCTTGCTACTTGGGGAACCTGCCGTTCAGAGTCTGGAAGAAGATGCAGGACATTGTCTACTATAGTGAGTCTATACAAAATCTCTACTCTTAAACAGAGGTTCTCAATTCTGGCCCTGGCAGCCCCCTCTCTGCATATTTTGTACATTTCTTGTACTGCTTCAGAGGCCATTATACATTTATATAGTGCATTACTTAAACACAGGGCCGGAGTGGGACTTCTTTTCAGCCCTGGAGTTTCAAGCCTCAGACCGGCCCACCTCAGTTCACGGCTGACTATATTAAAATAAGGTCATTTCCAATTCATTTTCTAATGACACTATCACGTCTTTTTTGAGAAAACAGCTGCTTTACAACTTCAAATGTTCAACAACCCTAACAGTATTATATATCTTAACAATAAAAATGAAAAAAAATAAATAATTACTCCGATGAGGATCAAACC
Associated Phenotype:
Not determined