Busch Lab

ZMP

cnksr1

Ensembl ID:
ENSDARG00000032932
ZFIN ID:
ZDB-GENE-040426-1802
Description:
connector enhancer of kinase suppressor of ras 1 [Source:RefSeq peptide;Acc:NP_991222]
Human Orthologue:
CNKSR1
Human Description:
connector enhancer of kinase suppressor of Ras 1 [Source:HGNC Symbol;Acc:19700]
Mouse Orthologue:
Cnksr1
Mouse Description:
connector enhancer of kinase suppressor of Ras 1 Gene [Source:MGI Symbol;Acc:MGI:2670958]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa42946 Nonsense Mutation detected in F1 DNA Not yet available
sa6479 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa45610 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42946
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050018 Nonsense 80 780 3 21
Genomic Location (Zv9):
Chromosome 17 (position 26880149)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 27020068
GRCz11 17 27038459
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTCCCCATGTCTGCACAGACCTACAGTGTTGGGGGTGACAGTCTG[C/T]GAAGTTTGACGGAGAAGCTTCGTGCAGTGGCACATACTCTGCAGATGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6479
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050018 Essential Splice Site 180 780 5 21
Genomic Location (Zv9):
Chromosome 17 (position 26865504)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 27005423
GRCz11 17 27023814
KASP Assay ID:
554-4881.1 (used for ordering genotyping assays)
KASP Sequence:
CCTGTAGGAAACCGCTGTGTTTGAAAAGGAGAAGGAMATCATATCCATAG[T/A]AAGTTCACTCTTACTTTTTTCATGACTCTTGATTCTTTGATTTAATACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45610
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050018 Nonsense 358 780 11 21
Genomic Location (Zv9):
Chromosome 17 (position 26847144)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26987063
GRCz11 17 27005454
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAGGCGGGAGAAATCGGCTCTCGCTAATGATCAAAGCTCCAATGAATA[T/A]CAGTCAGGCACCCTAAAACGGCTTCAGCCAGGAACAGGTAAGAGTCGCTG
Associated Phenotype:
Not determined