Busch Lab

ZMP

si:ch211-194e15.1

Ensembl ID:
ENSDARG00000032876
ZFIN ID:
ZDB-GENE-060503-297
Description:
tRNA dimethylallyltransferase, mitochondrial [Source:RefSeq peptide;Acc:NP_001038239]
Human Orthologue:
TRIT1
Human Description:
tRNA isopentenyltransferase 1 [Source:HGNC Symbol;Acc:20286]
Mouse Orthologue:
Trit1
Mouse Description:
tRNA isopentenyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1914216]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa36863 Nonsense Mutation detected in F1 DNA Not yet available
sa14214 Nonsense Available for shipment Available now
sa23552 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19216
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045504 Nonsense 20 455 1 11
ENSDART00000125893 Nonsense 20 330 1 9
ENSDART00000128560 Nonsense 20 447 1 11

The following transcripts of ENSDARG00000032876 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 32045327)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31212616
GRCz11 19 30799929
KASP Assay ID:
2261-3452.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCACGCGTGTACTCCAGAAAGGTATCAAGCCCTCTTTAGTGGTGATTT[T/A]AGGAGCAACTGGAACTGGCAAATCTAAACTGGCTATCGAGATCGGGAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3031
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045504 Nonsense 277 455 7 11
ENSDART00000125893 Nonsense 269 330 7 9
ENSDART00000128560 Nonsense 269 447 7 11

The following transcripts of ENSDARG00000032876 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 31989203)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31156492
GRCz11 19 30743805
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGAATCWGTTTTTTTTTTTTTTTTTTCTCTTTATTTTCAGTCAGAACTA[T/A]CAACAMGGCATATTCCAGTCTATTGGTTTTAAAGAGTTTCACGAGTACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36863
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045504 Nonsense 373 455 9 11
ENSDART00000125893 None None 330 None 9
ENSDART00000128560 Nonsense 365 447 9 11

The following transcripts of ENSDARG00000032876 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 31969583)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31136872
GRCz11 19 30724185
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGGGAGACTACTGTACTTACTCCTGCTCTAGAGATCCTGGACTGCCTC[C/T]AAAAGGTTTGACTTGTTTCCATTTACTTTTAATGTCTTCCTTACACATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14214
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045504 Nonsense 410 455 10 11
ENSDART00000125893 None None 330 None 9
ENSDART00000128560 Nonsense 402 447 10 11

The following transcripts of ENSDARG00000032876 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 31969266)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31136555
GRCz11 19 30723868
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCGGAGTCATCACATGTGCGATCTGTGCGAAAAGGTAATCATTGGAGACT[T/A]GGAATGGACRGGTGAGTTTTTAATYTAGTAAAACYAGTGCGTTCTCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23552
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045504 Nonsense 423 455 11 11
ENSDART00000125893 None None 330 None 9
ENSDART00000128560 Nonsense 415 447 11 11

The following transcripts of ENSDARG00000032876 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 31969136)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31136425
GRCz11 19 30723738
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCACCTGTCTTGACTTTTAGCTCACCAGAAGTCCAAAAACCATCTTTA[T/G]CAAGTCCGTAAGAAGAGGAAATCAGAGCAGGCCACAGATCTGGATACAAA
Associated Phenotype:
Not determined