Busch Lab

ZMP

PDE4B (1 of 3)

Ensembl ID:
ENSDARG00000032868
Description:
phosphodiesterase 4B, cAMP-specific [Source:HGNC Symbol;Acc:8781]
Human Orthologue:
PDE4B
Human Description:
phosphodiesterase 4B, cAMP-specific [Source:HGNC Symbol;Acc:8781]
Mouse Orthologue:
Pde4b
Mouse Description:
phosphodiesterase 4B, cAMP specific Gene [Source:MGI Symbol;Acc:MGI:99557]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa44638 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38555 Nonsense Mutation detected in F1 DNA Not yet available
sa40714 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44638
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028612 Essential Splice Site 388 783 11 18
Genomic Location (Zv9):
Chromosome 6 (position 30547903)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30868819
GRCz11 6 30855733
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCGCTCGATTTGGCGTCAAAACTGACAAAGAGGATTTACTGTCAAAGG[T/C]AAGGAGAAGACTGACTAATACTGGCTCTTTAGTGTGTTGGGATGTGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38555
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028612 Nonsense 396 783 12 18
Genomic Location (Zv9):
Chromosome 6 (position 30547783)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30868699
GRCz11 6 30855613
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCATTTCCTGACTCTTCTCTTTCCAGGAATTAGAAGACCTGAATAGATG[G/A]GGCTTGAATATCTTTACTGTTTCAGAGTATTCAAACAACCGGCCTCTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40714
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028612 Essential Splice Site 602 783 16 18
Genomic Location (Zv9):
Chromosome 6 (position 30546774)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30867690
GRCz11 6 30854604
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACAAGCTCGGGAGTCTTGCTTCTGGACAACTACACAGACAGGATACAG[G/A]TACAGTAAAGGCTTCCTGATCTCCATTCCCTCAGTAAAACCAGTTGTTAG
Associated Phenotype:
Not determined