Busch Lab

ZMP

si:dkey-206f10.1

Ensembl ID:
ENSDARG00000032838
ZFIN ID:
ZDB-GENE-041014-154
Description:
Novel protein similar to vertebrate adenylate cyclase 8 (ADCY8) [Source:UniProtKB/TrEMBL;Acc:Q5RHR1]
Human Orthologue:
ADCY8
Human Description:
adenylate cyclase 8 (brain) [Source:HGNC Symbol;Acc:239]
Mouse Orthologue:
Adcy8
Mouse Description:
adenylate cyclase 8 Gene [Source:MGI Symbol;Acc:MGI:1341110]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa37142 Nonsense Mutation detected in F1 DNA Not yet available
sa43520 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37142
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041444 Nonsense 243 1187 1 18
ENSDART00000134262 None None 315 None 5
ENSDART00000142543 Nonsense 243 755 1 10
Genomic Location (Zv9):
Chromosome 20 (position 43645720)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43716879
GRCz11 20 43613957
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGCTGGCTGTCTCAGACTGCTCAGGTGTTGGGTGGGCTGGCGTATGGCT[T/A]GGAAAGAGACCAGTCCTGGTATGTTCTGTTCACTTTGTTTGCCACATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43520
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041444 Nonsense 507 1187 6 18
ENSDART00000134262 None None 315 None 5
ENSDART00000142543 Nonsense 507 755 6 10
Genomic Location (Zv9):
Chromosome 20 (position 43655996)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43727155
GRCz11 20 43624233
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTTCTTTGTGGGGTCCTTGGACTACAAAAATGGCAGTTTGATGTGTG[G/A]TCCTGGGATGTGGGCATTGCCAACATGCTCGAAGCTGGTGGAATCCCTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29445
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041444 Essential Splice Site 591 1187 7 18
ENSDART00000134262 None None 315 None 5
ENSDART00000142543 Essential Splice Site 591 755 7 10
Genomic Location (Zv9):
Chromosome 20 (position 43656406)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43727565
GRCz11 20 43624643
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGAACATCCAAAAACCCGGCATAACAACCGCCCCTGGAATAAAGAGG[T/C]GACAATTAGTGATATCATTGATCAAAGCTGTCTGCTGGTGATTTTCAGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29446
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041444 Nonsense 962 1187 15 18
ENSDART00000134262 Nonsense 89 315 2 5
ENSDART00000142543 None None 755 None 10
Genomic Location (Zv9):
Chromosome 20 (position 43669912)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43741071
GRCz11 20 43638149
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAATGACTACTATGAGCAGAAGGAGATCAAGCACGAGGGAGTTGAGTG[T/A]CTCAAATTGCTCAATGAGATCATTGCAGACTTTGATGAGGTAGGAATTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1843
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041444 Nonsense 1124 1187 18 18
ENSDART00000134262 Nonsense 252 315 5 5
ENSDART00000142543 None None 755 None 10
Genomic Location (Zv9):
Chromosome 20 (position 43675705)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43746864
GRCz11 20 43643942
KASP Assay ID:
554-1834.1 (used for ordering genotyping assays)
KASP Sequence:
GAGATATACATAAAGGGCGTCAGTGAGAGAAAGGGACGTGTCCGGACTTA[C/A]TTCATCAGCACCAAAAGACGTTTGGTGTCAAGTAATGGGATTGCAGACAG
Associated Phenotype:
Not determined