Busch Lab

ZMP

htra1a

Ensembl ID:
ENSDARG00000032831
ZFIN ID:
ZDB-GENE-040704-64
Description:
HtrA serine peptidase 1a [Source:RefSeq peptide;Acc:NP_001002219]
Human Orthologue:
HTRA1
Human Description:
HtrA serine peptidase 1 [Source:HGNC Symbol;Acc:9476]
Mouse Orthologue:
Htra1
Mouse Description:
HtrA serine peptidase 1 Gene [Source:MGI Symbol;Acc:MGI:1929076]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa18228 Nonsense Available for shipment Available now
sa23058 Nonsense Available for shipment Available now
sa10864 Nonsense Available for shipment Available now
sa12950 Nonsense Available for shipment Available now
sa1585 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18228
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048136 Nonsense 165 479 2 9
Genomic Location (Zv9):
Chromosome 17 (position 21765594)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21915743
GRCz11 17 21935579
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTCTCTGTTGTTTTTRTTTCAGCTCTCCATGATAACCCCAACAGCCTG[C/T]GATACAAGTACAATTTCATTGCRGWTGTCGTAGAGAAAATCGCCCCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23058
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048136 Nonsense 257 479 3 9
Genomic Location (Zv9):
Chromosome 17 (position 21765945)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21916094
GRCz11 17 21935930
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCAAAGATGTTGATGAAAAAGCAGACATCGCACTTATAAAGATTGATT[T/A]GCCGGTAAGAGAAGCAAACACAATGCTTTTACATTTGCAACATAAAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10864
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048136 Nonsense 331 479 5 9
Genomic Location (Zv9):
Chromosome 17 (position 21784327)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21934476
GRCz11 17 21954312
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAMCTAATKAAATGNTTTTTTTTTACAGTATGGCAACTCAGGAGGACCAT[T/A]RGTTAATCTGGTGAGCACTTCYTCATTTCCGAACTGCTGAAATATACCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12950
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048136 Nonsense 381 479 7 9
Genomic Location (Zv9):
Chromosome 17 (position 21785121)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21935270
GRCz11 17 21955106
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTAACATTTGTGGTGTTTTWCAGGTCGAGGAACAAYAAAGAAAAGATA[T/A]ATCGGTGTYCGGATGATGACCCTCACTCCTTCGYGAGTACATGCAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1585
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048136 Essential Splice Site 392 479 7 9
Genomic Location (Zv9):
Chromosome 17 (position 21785155)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21935304
GRCz11 17 21955140
KASP Assay ID:
554-1527.1 (used for ordering genotyping assays)
KASP Sequence:
CAACAAAGAAAAGATATATCGGTGTTCGGATGATGACCCTCACTCCTTCG[T/C]GAGTACATGCAACAAATTAATACTTATTTTAATAAGCCTAAGGAAAATTT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2909
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048136 Essential Splice Site 392 479 8 9
Genomic Location (Zv9):
Chromosome 17 (position 21785345)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21935494
GRCz11 17 21955330
KASP Assay ID:
554-2864.1 (used for ordering genotyping assays)
KASP Sequence:
TTGGGAATGGAAACRGCAGATCTGACGTAATTGTATTCATCGACTCTTGC[A/T]GATTGTCCAAAGAGCTGAAAGGTCGACTGCGAGATTTCCCTGACATCACC
Associated Phenotype:
Not determined