Busch Lab

ZMP

kcnd2

Ensembl ID:
ENSDARG00000032799
ZFIN ID:
ZDB-GENE-041210-70
Description:
potassium voltage-gated channel subfamily D member 2 [Source:RefSeq peptide;Acc:NP_001076336]
Human Orthologue:
KCND2
Human Description:
potassium voltage-gated channel, Shal-related subfamily, member 2 [Source:HGNC Symbol;Acc:6238]
Mouse Orthologue:
Kcnd2
Mouse Description:
potassium voltage-gated channel, Shal-related family, member 2 Gene [Source:MGI Symbol;Acc:MGI:10266

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20218 Nonsense Available for shipment Available now
sa20219 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3497
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042673 Nonsense 137 630 1 6
ENSDART00000138890 Nonsense 137 630 2 7
Genomic Location (Zv9):
Chromosome 4 (position 9431541)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10368168
GRCz11 4 10367017
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTTCGGCATCATTCCAGAGATAATAGGTGACTGCTGTTATGAGGAATAC[A/T]AAGATCGCAGAAGGGAGAACGCGGAGAGAATTCAAGACGATGAGGAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20218
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042673 Nonsense 314 630 1 6
ENSDART00000138890 Nonsense 314 630 2 7
Genomic Location (Zv9):
Chromosome 4 (position 9432074)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10368701
GRCz11 4 10367550
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGATTTTCAAATTTTCGCGGCACTCCGCGGGGCTGCGCATCCTGGGCTA[C/A]ACGCTGAAGAGCTGCGCGTCCGAGCTGGGCTTCCTGCTCTTCTCGCTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20219
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042673 Nonsense 445 630 3 6
ENSDART00000138890 Nonsense 445 630 4 7
Genomic Location (Zv9):
Chromosome 4 (position 9613042)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10549669
GRCz11 4 10548518
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTTGCTAGAATTCGTGCGGCGAAGAGCGGCGGCGCTAACGCTTATTTG[C/T]AGTACAAACGCAATGGGATGCTGGTGGACATGGAGGAGGAGGTAACGGTG
Associated Phenotype:
Not determined