Busch Lab

ZMP

zgc:154088

Ensembl ID:
ENSDARG00000032769
ZFIN ID:
ZDB-GENE-061013-597
Description:
Putative sodium-coupled neutral amino acid transporter 9 [Source:UniProtKB/Swiss-Prot;Acc:Q08BA4]
Human Orthologue:
SLC38A9
Human Description:
solute carrier family 38, member 9 [Source:HGNC Symbol;Acc:26907]
Mouse Orthologue:
Slc38a9
Mouse Description:
solute carrier family 38, member 9 Gene [Source:MGI Symbol;Acc:MGI:1918839]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa7342 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2576
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041068 Nonsense 97 549 4 15
Genomic Location (Zv9):
Chromosome 10 (position 6581508)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6958136
GRCz11 10 6916836
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCATGAGGATATCTATATCTACAGTCCGCTGGGAACAGCGTTCAAAGTG[C/T]AGGGAGGAGACAGCCCTRTCAAAAACCCCAGCATTGTCACAATGTAAGAC
Long Flanking Sequence:
CACACACAAAATAATGAGGAACACAAGGATATGATTCATTTGTTAGTTGTTTTGATTATTCATATGGCAATTATTCTGAAGCCAAAATTAGCTGATTGTGAGATCATTCTGCTGTTTGAGGGCTGAAAGTCGAGGATGAAAATCTCTTATAATGCCATTTAACAGTGATTTCTACTGTTTGTATCTGTGTGTAATTAAGTTAGTCCATGGCTTTGATTCCTTTTTTCTTCTGCACTGTTTGGTTTGTGGAGGATGCGCTTTTAAATGCAGATTAACATGGTCTTCAAGCATAAATTCTGCTTTTTGTCAATCATTCAGCACAATGCATTATTTGTTTAGGGACTTGTGAAGTTTATGATCTAGTCCAATAGAGTATTATAGGCTCTGTGATGTAACGGATTTGCTTATGCACCTTATCTCTGCAGGCACCTCCAGACCACGTGATTCCTTCTCATGAGGATATCTATATCTACAGTCCGCTGGGAACAGCGTTCAAAGTG[C/T]AGGGAGGAGACAGCCCTATCAAAAACCCCAGCATTGTCACAATGTAAGACCACCCTCAGAGCAGTTTTAGACTGAAATGCAAAATTAAAGCTTTCTAGTCTGCATGTGTGAAAATATAGTCAGTATGAAAAGTTTGTAGATTGATGTGATGATGTTCCCAACACGATCTTATGGCAACTTGTAACCATTTTGCTGCAATTTGTAAAATGTCATTCATGTTTATTTGACTTGCTTAGAAGAAATAAGTCAAGCTTTAATAATGGGCGTATTATCTTCCTATTATTTTAATATTGGCTGTTTATTTGTAGTTGTAAAACATATTCTGCATAATATTATTCCTACCCAATACTTAAACCCAATACCTGTTAATAAGCAGCAGATTAGGAGTTTCAGGCAAAAACTGTTAATGCTTTGGTAACAGTGAGAATTTAACCTTTAAAATAAAGTATGACTTAATTTATATACATACATACACACACACACACACACACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7342
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041068 Missense 207 549 7 15
Genomic Location (Zv9):
Chromosome 10 (position 6585133)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6961649
GRCz11 10 6920349
KASP Assay ID:
554-4220.1 (used for ordering genotyping assays)
KASP Sequence:
CRTCTTCTCGTTGGTGTCACTGATTGGTGCAATGGTGGTCTACTGGGTGC[T/C]CATGTCYAACTTCCTGTTCAATACGGGAAAATTCATTTTCAGTACGTGAC
Long Flanking Sequence:
AAGCAAGTTATTTTATAATGATGGTTTGTTCTGTTGACTATCGAAAAAATATATTGCTTAATGGGGCTAATAATATTGACTTTACAATTGTTTTTAAAAAATTTACAGCTGCTTTTATTCTAGCCAAAATAAACCAAATAATACTTTTTTTAGAAGAAAAAAATATTATCAGAAAAATTGTGAAAATGTCTTTGCTCTGTTAAACATAATTTGGGAAATATTTAAAAAAGCAAAAAAATAAAATAAAAAATTCAAAGGGGGCTTATAATTCTGACTTTAACTGTATGTCATTTTTGCTTGTCTTTTTTTCATATGTCATGCCAGAGTTAACATGAAGTTTTTTTTAAATATGAAACTCTGTGTCTTTGCAGCTTATGTAGATACCTCAGACTGGGAGTTTCCTGATGTGTGTAAATATTACTTTGGGGGTTTCGGAAAATGGTCCAGTCTCGTCTTCTCGTTGGTGTCACTGATTGGTGCAATGGTGGTCTACTGGGTGC[T/C]CATGTCTAACTTCCTGTTCAATACGGGAAAATTCATTTTCAGTACGTGACTGTTTTTCCTGCCCTTTCTCATTTGTTTTACTGCCAATTAGAATTCTAATATTGTTTTTCTGAATAACCTTTTAATTGTTTTTCTGAATAACCTTTTATATATTTTGCATTTACAGACTATGTTCACAATGTCAACACATCAGATGCATTTGGCACAAATGGAACTGAGAGAGGTGAGCAGTCATTATTATTATTATCATTATTAGTATAAAATAGTCTGAAGTTGTAAGCATAATCATTTACATTACATGGTCAAAGATACTCAACACAATCCAAATGGCTTGATTTATTAATTGCTCTGACTTGAGGCTGATTTATACTTCTGCATCAAGAGCACGTGTATGCTACGGCGTTAATGCATAGCCCTACGCCGTGGCCGTTGGCGTCGCTGACGTGCACCTTTCAAAAAGTGTAATTACACATCGCAACGAGGCGTAGTGTAAGCTCTGT
Associated Phenotype:
Not determined