Busch Lab

ZMP

pde4d

Ensembl ID:
ENSDARG00000032761
ZFIN ID:
ZDB-GENE-081105-16
Description:
Novel protein similar to vertebrate phosphodiesterase 4D, cAMP-specific (Phosphodiesterase E3 dunce
Human Orthologue:
PDE4D
Human Description:
phosphodiesterase 4D, cAMP-specific [Source:HGNC Symbol;Acc:8783]
Mouse Orthologue:
Pde4d
Mouse Description:
phosphodiesterase 4D, cAMP specific Gene [Source:MGI Symbol;Acc:MGI:99555]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa45318 Nonsense Mutation detected in F1 DNA Not yet available
sa117 Nonsense Confirmed mutation in F2 line Not yet available
sa18915 Nonsense Mutation detected in F1 DNA Not yet available
sa9416 Nonsense Available for shipment Available now
sa14598 Nonsense Available for shipment Available now
sa41163 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5473
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018934 Nonsense 71 725 2 17
ENSDART00000139452 None None 665 None 14
Genomic Location (Zv9):
Chromosome 8 (position 17329439)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16774327
GRCz11 8 16810039
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGAGCAGTATTACTGTGAGAGGAGACCAGAGACGGAGACGGTCCAGCCT[C/T]GACCCACCAGCCTCCCCCTGAGAGTTCCTCCGCTCATCGCCATCACCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45318
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018934 Nonsense 139 725 3 17
ENSDART00000139452 Nonsense 48 665 1 14
Genomic Location (Zv9):
Chromosome 8 (position 17528740)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16973628
GRCz11 8 17009340
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCCACAGCCAGAGGAGAGAGTCCTTTCTGTACCGTTCAGACAGTGACTA[C/A]GACCTCTCACCAAAGTCCATGTCCAGAAACTCCTCCATCGCCAGTGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa117
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018934 Nonsense 380 725 11 17
ENSDART00000139452 Nonsense 289 665 9 14
Genomic Location (Zv9):
Chromosome 8 (position 17554468)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16999356
GRCz11 8 17035068
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTAACAAGGTACTTCTGTGCTGTAGGAGAGGGACTTGTTAAAGACGTTT[A/T]AAATTCCCCTCGACACGTTTATCACCTATCTGATGACTTTAGAGGACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18915
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018934 Nonsense 389 725 11 17
ENSDART00000139452 Nonsense 298 665 9 14
ENSDART00000018934 Nonsense 389 725 11 17
ENSDART00000139452 Nonsense 298 665 9 14
Genomic Location (Zv9):
Chromosome 8 (position 17554497)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16999385
GRCz11 8 17035097
KASP Assay ID:
2260-0359.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGACTTGTTAAAGACGTTTAAAATTCCCCTCGACACGTTTATCACCTA[T/A]CTGATGACTTTAGAGGACCATTATCATGCTGACGTTGCCTATCACAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9416
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018934 Nonsense 389 725 11 17
ENSDART00000139452 Nonsense 298 665 9 14
ENSDART00000018934 Nonsense 389 725 11 17
ENSDART00000139452 Nonsense 298 665 9 14
Genomic Location (Zv9):
Chromosome 8 (position 17554497)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16999385
GRCz11 8 17035097
KASP Assay ID:
2260-0359.1 (used for ordering genotyping assays)
KASP Sequence:
AGGGACTTGTTAAAGACGTTTAAAATTCCCCTCGACACGTTTATCACCTA[T/A]CTGATGACTTTAGAGGAYCATTATCATGCYGACGTTGCCTATCACAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14598
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018934 Nonsense 490 725 13 17
ENSDART00000139452 Nonsense 399 665 11 14
Genomic Location (Zv9):
Chromosome 8 (position 17558549)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17003437
GRCz11 8 17039149
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGAATCATCATCTAGCTGTTGGCTTTAAGCTGCTTCAGGARGAAAACTG[T/A]GACATCTTCCAGAACCTGACCAAGAAACAGAGACAGTCGCTCCGCAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41163
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018934 Nonsense 649 725 16 17
ENSDART00000139452 Nonsense 558 665 14 14
Genomic Location (Zv9):
Chromosome 8 (position 17563733)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17008621
GRCz11 8 17044333
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCCAGATGCTCAGGACATCCTGGACACGCTGGAGGACAACAGAGAGTG[G/A]TACCAGAGCACCATCCCGCAGAGCCCGTCTCCAGCACTGGACACCAGCAG
Associated Phenotype:
Not determined