Busch Lab

ZMP

farsa

Ensembl ID:
ENSDARG00000032750
ZFIN ID:
ZDB-GENE-050512-2
Description:
Phenylalanyl-tRNA synthetase alpha chain [Source:UniProtKB/Swiss-Prot;Acc:Q1JPX3]
Human Orthologue:
FARSA
Human Description:
phenylalanyl-tRNA synthetase, alpha subunit [Source:HGNC Symbol;Acc:3592]
Mouse Orthologue:
Farsa
Mouse Description:
phenylalanyl-tRNA synthetase, alpha subunit Gene [Source:MGI Symbol;Acc:MGI:1913840]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa25956 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25956
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033738 Essential Splice Site 49 497 1 13
Genomic Location (Zv9):
Chromosome 3 (position 405762)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 13729790
GRCz11 3 13879636
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCATCAGCTCGTCGTGGGCGCCGTGAAGAGCCTGCAGGCGCTGGGAGAG[G/A]TGAGGGGATCAGACACAGACACACACCGCTGACTGACTGATGCAACAGCA
Long Flanking Sequence:
ATGCCAGTGCCGGAAAAATGCCTGCTGTGCCAGATTTATGCCAAATCTGAGCCAGAATTCTTTGCTACCTGGGTATATAGGCTAAGTACAGTGCTGCTTTCGAATAAAAGCTAAATAGTTGCTCGTTATTTAAAACGGACGTTCAACACATCTGCTCTTATTTTATTTAATAAAGGTTGTGGACCGATTGAAACCCCATATACTATTAATATAACATATATACTAAAAACGTGTATGACTTGAGCCGCTCTTCATCGTTTACGGTAGAATAATTGCATGCGCTTTTGTTACCGTGTTTACGGTTGTCGTGACGTCATGTCCGCTTCCCCTTCGGAACGCGAGGCGACTCCAGCATGGCTGACACCGGGCTTTTAGAAGCGCTGCTGCAGCGGGTGGAGCAGTTGGACGGCGGGGTGGACAGCCAGGATGTGTCCGCGGCTCTCGGCGTGGATCATCAGCTCGTCGTGGGCGCCGTGAAGAGCCTGCAGGCGCTGGGAGAG[G/A]TGAGGGGATCAGACACAGACACACACCGCTGACTGACTGATGCAACAGCAGAGACACTGCGGCTAAGCTGACAGTACCAACCGTTTCACTACACAAACGACAACACAGGAATAAATGCTGATCTTAAACACCAGCAAGCCTGACTCTACAGCTGATAATGCCTGTCTGTCTGTCTATTAATTGTCTGTATTTCTATCTTTTTTTCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCAATTGTCTGTCGTTCTATCTTTATGTATCTGTCTGTCTGTCTATCTACCGTTCTTTCTATCGTTCTATTGTATTCAATTTTTTCTGTCTGTTTGTCTATCCATATATATATATTCTTTCTATTTATCTCTCTTTAATCTATCCATCAGTCCATCTGTCTATATCTACCTTTATTTTATCCACCTGTGCCTTAAAGTTAAGTAAATAAACTATGTGAGTGCAATTACAGTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25957
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033738 Essential Splice Site 49 497 1 13
Genomic Location (Zv9):
Chromosome 3 (position 405763)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 13729791
GRCz11 3 13879637
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATCAGCTCGTCGTGGGCGCCGTGAAGAGCCTGCAGGCGCTGGGAGAGG[T/G]GAGGGGATCAGACACAGACACACACCGCTGACTGACTGATGCAACAGCAG
Long Flanking Sequence:
TGCCAGTGCCGGAAAAATGCCTGCTGTGCCAGATTTATGCCAAATCTGAGCCAGAATTCTTTGCTACCTGGGTATATAGGCTAAGTACAGTGCTGCTTTCGAATAAAAGCTAAATAGTTGCTCGTTATTTAAAACGGACGTTCAACACATCTGCTCTTATTTTATTTAATAAAGGTTGTGGACCGATTGAAACCCCATATACTATTAATATAACATATATACTAAAAACGTGTATGACTTGAGCCGCTCTTCATCGTTTACGGTAGAATAATTGCATGCGCTTTTGTTACCGTGTTTACGGTTGTCGTGACGTCATGTCCGCTTCCCCTTCGGAACGCGAGGCGACTCCAGCATGGCTGACACCGGGCTTTTAGAAGCGCTGCTGCAGCGGGTGGAGCAGTTGGACGGCGGGGTGGACAGCCAGGATGTGTCCGCGGCTCTCGGCGTGGATCATCAGCTCGTCGTGGGCGCCGTGAAGAGCCTGCAGGCGCTGGGAGAGG[T/G]GAGGGGATCAGACACAGACACACACCGCTGACTGACTGATGCAACAGCAGAGACACTGCGGCTAAGCTGACAGTACCAACCGTTTCACTACACAAACGACAACACAGGAATAAATGCTGATCTTAAACACCAGCAAGCCTGACTCTACAGCTGATAATGCCTGTCTGTCTGTCTATTAATTGTCTGTATTTCTATCTTTTTTTCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCAATTGTCTGTCGTTCTATCTTTATGTATCTGTCTGTCTGTCTATCTACCGTTCTTTCTATCGTTCTATTGTATTCAATTTTTTCTGTCTGTTTGTCTATCCATATATATATATTCTTTCTATTTATCTCTCTTTAATCTATCCATCAGTCCATCTGTCTATATCTACCTTTATTTTATCCACCTGTGCCTTAAAGTTAAGTAAATAAACTATGTGAGTGCAATTACAGTAAA
Associated Phenotype:
Not determined