Busch Lab

ZMP

pmp22a

Ensembl ID:
ENSDARG00000032724
ZFIN ID:
ZDB-GENE-030131-6757
Description:
peripheral myelin protein 22a [Source:RefSeq peptide;Acc:NP_958468]
Human Orthologue:
PMP22
Human Description:
peripheral myelin protein 22 [Source:HGNC Symbol;Acc:9118]
Mouse Orthologue:
Pmp22
Mouse Description:
peripheral myelin protein 22 Gene [Source:MGI Symbol;Acc:MGI:97631]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26141
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050210 Essential Splice Site None 157 2 6
ENSDART00000127516 None None 157 None 5
ENSDART00000142226 None None 157 None 5
Genomic Location (Zv9):
Chromosome 3 (position 48060411)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 49822874
GRCz11 3 50862863
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAAACGCTGCTCGGGAGTGTTTTCTTTTTGACTACTTCAGAAAAATGGG[C/T]AAGTTTACACTTCTCAATAACTTTAGTCGTCAAATGCTTGATATTCTCTC
Long Flanking Sequence:
TGGTACTACATCTGGAATACGGAGACGCGTGCTTTGAGAATCTATAGTGGGATACCATAGAAAAGGCGACTTGTGTTTTCTTCCTGCTCTCTTGCATTTCAAGGATTTTTCTTCTCTTTCTCTCTCTCTTACCTGTAAGTTGGAGAACCATAGAAGTTTTCTATTTTTACTTTGGTCCTTTTTGAATGAACATTTGCATGCCATTTCAGGAGATTCTCAACCACATTTGTGTTTAGTAGTATATTCCAAGGCTATACTTTGGCAAGTTGCACAAGTTTGTTATTCAAAGTATATTTTCATCCTCACACGGTTTAAATTATTTTTAAAATAAGTTATAACATTAAGTATTAGTTTTGCATTGCCAGCTTTAGTTTTGTGTGAACACATCTTTCGTCTTCTCTAAAGGCACGGTTGGCGTGCGGAGTTTTGCAATAACTGGTTTGGATGAAAATAAACGCTGCTCGGGAGTGTTTTCTTTTTGACTACTTCAGAAAAATGGG[C/T]AAGTTTACACTTCTCAATAACTTTAGTCGTCAAATGCTTGATATTCTCTCAGAATAGGCATTTGTAGCGAGATAGCAAAACCTGTAACATATAAACTAACAGATAAACACTTTGAAGAGACGTGACGGAAAAAAGGCGGCACGCGAGAAAAAAAAGGGATGTGACTGGATTGTATGTGTGTATTTAGTTGCAGTATTGTGTTTTTGTTTTGATTAAATACAGACATTTTAAAAGCCTTAAAAGATTGCAACGGGATTAGTGCTATTATCAAAGCAATGTGTCAAGAATACAGATGTTTTCAATTAAAATGTAGATAAGAAAACAGGCGGCAGTGATAGTGTTTGGGTTGAGATACCTTTGACAAAGGCGCGGTCTTGTGGCCAGATGAGGAACTGCAAGAGTAAACATTGTCCATCACAAAACCCGCCAGGTATGTGCTTTAACTTTTATTACTTACTCTTTCTGTTCTTTTAGAAGAAACCCAAAATGCTGGTCATTCT
Associated Phenotype:
Not determined