Busch Lab

ZMP

qrsl1

Ensembl ID:
ENSDARG00000032704
ZFIN ID:
ZDB-GENE-030131-5540
Description:
glutamyl-tRNA(Gln) amidotransferase subunit A homolog [Source:RefSeq peptide;Acc:NP_001112370]
Human Orthologue:
QRSL1
Human Description:
glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1 [Source:HGNC Symbol;Acc:21020]
Mouse Orthologue:
Qrsl1
Mouse Description:
glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1 Gene [Source:MGI Symbol;Acc:MGI:1923813]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa9655 Nonsense Available for shipment Available now
sa11123 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9655
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045615 Nonsense 109 536 4 11

The following transcripts of ENSDARG00000032704 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 25406876)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25546795
GRCz11 17 25565186
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATGRTTGTGACATGTTTGATTCCCATTATCKGTTTGGATTGGTAGGTTA[T/A]GTTCCTCCATTCAGTGCTACAGTTGTGCAGAAGCTGTTGGATCARGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11123
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045615 Nonsense 504 536 11 11

The following transcripts of ENSDARG00000032704 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 25417293)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25557212
GRCz11 17 25575603
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGACACTACAAGACTGGAAATTGTTGACAATCGCCCACTGGATGGAGAAA[C/T]AACTCCACTTCCCAATGATCCGATTCCACRGGGACTTAAATGAAAATGAA
Associated Phenotype:
Not determined