Busch Lab

ZMP

FUK

Ensembl ID:
ENSDARG00000032650
Description:
fucokinase [Source:HGNC Symbol;Acc:29500]
Human Orthologue:
FUK
Human Description:
fucokinase [Source:HGNC Symbol;Acc:29500]
Mouse Orthologue:
Fuk
Mouse Description:
fucokinase Gene [Source:MGI Symbol;Acc:MGI:1916071]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa24603 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24603
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042928 Nonsense 134 602 2 11
Genomic Location (Zv9):
Chromosome 25 (position 7845656)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7408915
GRCz11 25 7583093
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGCAAACAGCAGTGGTGATCTGGGAGTAGCGGCCCGCTGTCTGGCCTG[T/A]ATCGCGGATGTTCTTGGCTGTCTGGCTGGTGAAGGGAAAGGTGGTTTGAG
Associated Phenotype:
Not determined