Busch Lab

ZMP

cd36

Ensembl ID:
ENSDARG00000032639
ZFIN ID:
ZDB-GENE-040718-55
Description:
platelet glycoprotein 4 [Source:RefSeq peptide;Acc:NP_001002363]
Human Orthologue:
CD36
Human Description:
CD36 molecule (thrombospondin receptor) [Source:HGNC Symbol;Acc:1663]
Mouse Orthologue:
Cd36
Mouse Description:
CD36 antigen Gene [Source:MGI Symbol;Acc:MGI:107899]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40295 Nonsense Mutation detected in F1 DNA Not yet available
sa9388 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40295
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050753 Nonsense 337 465 9 12
Genomic Location (Zv9):
Chromosome 4 (position 21596853)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22940188
GRCz11 4 22661163
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATATTTTCACAGGAACCCCAGTCTTCATCTCTCTGCCTCACTTCCTCTA[T/A]GCCAGTATTGAGCTCCAGCAGGGGGTGGTCGGAATGAACCCCAACTTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9388
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050753 Essential Splice Site 389 465 10 12
Genomic Location (Zv9):
Chromosome 4 (position 21595720)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22939055
GRCz11 4 22660030
KASP Assay ID:
2259-4937.1 (used for ordering genotyping assays)
KASP Sequence:
TCAAAAAGGCTTCAGGTCAACATGATGTACGGCCCATCCGACGAWATTGM[G/A]TATGTAAATCAATATCATGCATTGTCRTGAATGYTCATGCACATGCTGAA
Associated Phenotype:
Not determined