Busch Lab

ZMP

neb

Ensembl ID:
ENSDARG00000032630
ZFIN ID:
ZDB-GENE-041111-216
Description:
Novel protein similar to vertebrate nebulin (NEB) [Source:UniProtKB/TrEMBL;Acc:B0UY60]
Human Orthologue:
NEB
Human Description:
nebulin [Source:HGNC Symbol;Acc:7720]

Alleles

There are 25 alleles of this gene:

Allele Name Consequence Status Availability
sa154 Nonsense Confirmed mutation in F2 line Not yet available
sa41408 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa906 Nonsense Available for shipment Available now
sa34630 Nonsense Mutation detected in F1 DNA Not yet available
sa10635 Nonsense Available for shipment Available now
sa15371 Nonsense Available for shipment Available now
hu2849 Essential Splice Site Confirmed mutation in F2 line Not yet available
sa15997 Nonsense Available for shipment Available now
sa16506 Nonsense Available for shipment Available now
sa34629 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34628 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34627 Nonsense Mutation detected in F1 DNA Not yet available
sa21476 Essential Splice Site Available for shipment Available now
sa34626 Nonsense Available for shipment Available now
sa38738 Nonsense Mutation detected in F1 DNA Not yet available
sa11973 Nonsense Available for shipment Available now
sa11545 Essential Splice Site Available for shipment Available now
sa1610 Essential Splice Site Confirmed mutation in F2 line Not yet available
sa21475 Essential Splice Site Available for shipment Available now
sa18354 Essential Splice Site Available for shipment Available now
sa30646 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa154
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Nonsense 58 6235 2 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Nonsense 81 6177 5 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23914397)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23070183
GRCz11 9 22881052
KASP Assay ID:
554-0041.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGGCAGCCCTACCTCATTTCGGCTGACACACCTGAGATGATTCGCATC[A/T]AAAAGGCCCAGGAGCAGCTAAGTGAGGTATGAACTGTACTATTGGGGGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27390
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Essential Splice Site 455 6235 14 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Essential Splice Site 478 6177 17 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23904469)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23060255
GRCz11 9 22871124
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATTATGATAGAATGTATTAACACTGACCCTGTTTTCTCTTCTTTTACA[G/T]CTCAACTACAAGGAAAAGTATGAGAAGGAGAAGTTTAAGTGTTACCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41408
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Essential Splice Site 666 6235 19 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Essential Splice Site 689 6177 22 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23902181)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23057967
GRCz11 9 22868836
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACTTTAGAAAATATTTTACAGTTATCAACCAACTGCATTTGTTCTCCT[A/T]GAAAAAATACAGGCAGCACCCAGACACCGTACCTTTTACTGCTATAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa906
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Nonsense 1288 6235 30 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Nonsense 1311 6177 33 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23895131)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23050917
GRCz11 9 22861786
KASP Assay ID:
554-0813.1 (used for ordering genotyping assays)
KASP Sequence:
ACGTTGGCTTCCGTAGCATCCAGGACGATCCCTTGCTGGTGCACTACATG[C/T]AGGTGGCAAAGATGCAGAGCGAGAGGAACTACAAGAAAGATTACCACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34630
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Nonsense 1554 6235 34 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Nonsense 1559 6177 37 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23893911)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23049697
GRCz11 9 22860566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTGCACTACATGCAGGTGGCAAAGATGCAGAGCGAGAGGAACTACAAG[A/T]AAGATTACCACAAGTCCAAGCTGAAATACCACACCCCTGTGGACATGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10635
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Nonsense 1929 6235 40 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Nonsense 1934 6177 43 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23891300)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23047086
GRCz11 9 22857955
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCYCAGTATGTTTTTGAAGATTTTAAAACTGGCTTTGTTTTTCCTTCAG[C/T]AAAAGTACATTTCYGCATGGGAAAAGGACAAAACCACAATCCACATTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15371
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Nonsense 2002 6235 42 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Nonsense 2007 6177 45 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23890907)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23046693
GRCz11 9 22857562
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTAYTGTGAAAGTGATTAATGTTTTAATGAACTTATCGCAGTACAAGTA[C/A]AAAGCYGGGTATCGTAAGCAAGTCGGTCACCACATTGGAGCTCGCAGTRT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu2849
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Essential Splice Site 2171 6235 43 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Essential Splice Site 2176 6177 46 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23890303)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23046089
GRCz11 9 22856958
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGACATGCCAATGGTCTTGGCCAAAGCCAATAATGATATCATGAATAAG[G/A]TCAGGTGCATATTTCATATCCAGACATATGAAATATATCTAAAATGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15997
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Nonsense 2285 6235 46 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Nonsense 2290 6177 49 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23889582)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23045368
GRCz11 9 22856237
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATGCTGGCCTTGAACTCAGCTAAGATTGCTAGTGATGCTCTGTACAAG[A/T]AAGACTTCAAMAAGTCTAAGACCAAGTTCCACCTCCCGGTGGACCTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16506
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Nonsense 2349 6235 47 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Nonsense 2354 6177 50 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23889186)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23044972
GRCz11 9 22855841
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTGCNTGAATGTTTTCTTTAAACATAATKTCTGCTTTTAGGCGGTGTA[C/A]AAAGCTGRTCTAAAATGGCTTCRAGGTCTTGGATGGGTTCCTATTGGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34629
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Essential Splice Site 2449 6235 48 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Essential Splice Site 2454 6177 51 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23888759)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23044545
GRCz11 9 22855414
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAATGGACATTGTACTAGCAAAACAAAACAGGGTCAACTACAGTTTGG[T/G]AAGTATAAGGGTGCTTTCGCACCTGCCTTATTTAGTTTGGTTGAATCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34628
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Essential Splice Site 2657 6235 51 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Essential Splice Site 2662 6177 54 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23886965)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23042751
GRCz11 9 22853620
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGATATGCCAATGGTCTTGGCAAAAGCCAATGCAAGCATCATGAACAAG[G/A]TAGCCTGCTTTGAACACTAAATGTTTCTTTCTTTTCATTGCAATGTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34627
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Nonsense 2729 6235 54 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Nonsense 2734 6177 57 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23886369)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23042155
GRCz11 9 22853024
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTAAAGATTAATTTATTTTTATTGTCTTTTAATAATTTAAATGTAGTA[C/A]AAGTACAAGACTGGTTATCGTAAGCAAGTTGGTCATCACATTGGAGCTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21476
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Essential Splice Site 3421 6235 64 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Essential Splice Site 3426 6177 67 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23883195)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23038981
GRCz11 9 22849850
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACCCCTGAGATCATCCTTGGAAAACAGAATAAACTCAACACAAGCATT[G/A]TAAGTGCAGCAGCACTGCTTTGTAGTAACCAATAAATCTTGAATAAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34626
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Nonsense 4021 6235 75 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Nonsense 4026 6177 78 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23879450)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23035236
GRCz11 9 22846105
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACATGCAAAGAAGTGCCAGATCCAAGTCAATGACGATAAATACAGAACT[C/T]GACTGCACCAGTGGACATGCTTGCCTGATCAGAATGATGTCATTCAGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38738
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Nonsense 4283 6235 81 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Nonsense 4252 6177 83 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23877987)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23033773
GRCz11 9 22844642
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCACCAGTGGACATGCCACCCTGAACAGAATGATGCCATCCGAGCACGC[A/T]AGGCCAATGAGATCTTGAGTGATGTAGGTTACTATTACAGTTATTCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11973
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Nonsense 4476 6235 87 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Nonsense 4445 6177 89 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23876861)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23032647
GRCz11 9 22843516
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAAACCTTGTCGTAATSTTTTRTCTCTTAGCGCCTGTACAAAGAAAACTA[T/A]GAGAAGACCAAAGCAAAAATCAATGTACCTCCCGACATGCTTGACATCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11545
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Essential Splice Site 4535 6235 87 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Essential Splice Site 4504 6177 89 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23876683)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23032469
GRCz11 9 22843338
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATGCAGGTGTACGTACATGCCCGYAAAGKCAATGAGCAACTGAGCGAC[G/T]TAAGTGACATRAAAGTTATAGCRAAGTCAAGTCAGAGTGCTAACTGGAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5537
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Essential Splice Site 4571 6235 89 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Essential Splice Site 4540 6177 91 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23876395)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23032181
GRCz11 9 22843050
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTCCTCTATCTTCTCACATGCTGTCTTCACCCTGGTGATTTTCTTTTTC[A/T]GAACTTGTACARAGCTAAAGGAATCGAGMACTTTAAGCAGTACACTGTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2529
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Essential Splice Site 4851 6235 96 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Essential Splice Site 4820 6177 98 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23874059)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23029845
GRCz11 9 22840714
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACACACCAGAGTACAAGCGAGTGACTGAACTCAAGACTCACATGAGTAAT[G/A]TAAGTAATTTTTACATCAGCATCAGGCTTAATATATCTTGTCTGGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1610
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Essential Splice Site 5062 6235 103 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Essential Splice Site 5031 6177 105 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23872277)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23028063
GRCz11 9 22838932
KASP Assay ID:
554-1551.1 (used for ordering genotyping assays)
KASP Sequence:
TAACAAAGCTTTRTCATACTTATTTGCTGCTGTTTAATTGTGTTTTTGAC[A/T]GAGACTCTACAAAGCATCATTTGAGAAAAACAGAGCCAACTTCAAGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21475
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Essential Splice Site 5097 6235 104 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Essential Splice Site 5066 6177 106 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23871807)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23027593
GRCz11 9 22838462
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACTGCTCTCGAGGCAGTTGTCTTTAACTCCAATTTTGAAATTCTGAGC[A/C]GAGGTCCTACCGTGCCAGCTATGAGAAGTCTAAGGATAAGTACACCATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18354
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Essential Splice Site 5586 6235 117 134
ENSDART00000101711 Essential Splice Site 156 610 5 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 Essential Splice Site 47 564 2 15
ENSDART00000143888 Essential Splice Site 5555 6177 119 135
ENSDART00000146486 Essential Splice Site 174 388 5 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23863867)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23019653
GRCz11 9 22830522
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGCAAGATATATCAGACTCTGAAGGATGCTAATACACTTGCAAGCGAG[G/T]TGCTTTTAAGACTAAAACATTTTTTNNNNNNNNNNGTCTATTTATAAATATTACCMATCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8337
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 None None 334 None 8
ENSDART00000061293 Nonsense 5654 6235 119 134
ENSDART00000101711 None None 610 None 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 None None 564 None 15
ENSDART00000143888 Nonsense 5623 6177 121 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23861116)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23016902
GRCz11 9 22827771
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGATMCCCGACACACCTGAGCRGCTTCACCACAAAGAAGCCTCAGAGCTG[C/T]AGAGTCACGTAAGTCACAAACAGTTCTGGTGYTTTCTGCAGCTGATCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30646
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032130 Essential Splice Site 243 334 7 8
ENSDART00000061293 Essential Splice Site 6144 6235 133 134
ENSDART00000101711 Essential Splice Site 519 610 16 17
ENSDART00000142020 None None 175 None 6
ENSDART00000142585 Essential Splice Site 473 564 14 15
ENSDART00000143888 Essential Splice Site 6086 6177 134 135
ENSDART00000146486 None None 388 None 11

The following transcripts of ENSDARG00000032630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 23839498)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22995284
GRCz11 9 22806153
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGATTGAAAGTACACTAATGCAGTGAAACCCCTGTTGTTCTCTCATACA[G/A]GATACACACAGACCAAGACCATTGAGGTTCAGCAGAGATCTTCCTCAGTG
Associated Phenotype:
Not determined