Busch Lab

ZMP

si:ch211-244b2.1

Ensembl ID:
ENSDARG00000032627
ZFIN ID:
ZDB-GENE-041210-205
Description:
hypothetical protein LOC557149 [Source:RefSeq peptide;Acc:NP_001074268]
Human Orthologue:
SCYL2
Human Description:
SCY1-like 2 (S. cerevisiae) [Source:HGNC Symbol;Acc:19286]
Mouse Orthologue:
Scyl2
Mouse Description:
SCY1-like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1289172]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20292 Nonsense Available for shipment Available now
sa20293 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20292
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039877 Nonsense 97 929 2 17
Genomic Location (Zv9):
Chromosome 4 (position 25145568)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 26069237
GRCz11 4 26058435
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAGATTATCGATTCACTGAAGAAAGGAATTCAACAGCTTACCAGATTA[C/T]GACATCCACGTCTCCTGACGGTTCAGCACCCGCTTGAAGAGTCCAGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20293
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039877 Essential Splice Site 323 929 6 17
Genomic Location (Zv9):
Chromosome 4 (position 25154572)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 26078241
GRCz11 4 26067439
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCAGCGTCACCTCCAACGTGCGTCCAGACGCAGACCAGATGACAAAGG[T/G]CAGATCTTTCCCTCCTTACTGCTGTTTTTCCAGGGATTTTTTTGTTTGGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2184
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039877 Nonsense 348 929 7 17
Genomic Location (Zv9):
Chromosome 4 (position 25155262)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 26078931
GRCz11 4 26068129
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGCGATGACTCTTCAGTACTTCGACTCGCTTTTCCAGCGGGACAACCTA[C/T]AGAAGTCTCAGTTCTTTAAAGGACTCCCGAAAGTGCTGCCTAAGCTGCCC
Associated Phenotype:
Not determined