Busch Lab

ZMP

fgfrl1a

Ensembl ID:
ENSDARG00000032617
ZFIN ID:
ZDB-GENE-040128-2
Description:
alpha-L-iduronidase [Source:RefSeq peptide;Acc:NP_956670]
Human Orthologue:
FGFRL1
Human Description:
fibroblast growth factor receptor-like 1 [Source:HGNC Symbol;Acc:3693]
Mouse Orthologue:
Fgfrl1
Mouse Description:
fibroblast growth factor receptor-like 1 Gene [Source:MGI Symbol;Acc:MGI:2150920]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
hu3328 Nonsense Available for shipment Available now
sa14717 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3901
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082667 Essential Splice Site 113 483 None 7
ENSDART00000147149 None 113 112 None 3
Genomic Location (Zv9):
Chromosome 14 (position 15333506)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 17195492
GRCz11 14 17501145
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACSAATGGATTYGGCAGTGTCAATATCAACTACACCCTCATCGTCATTGG[T/G]AAGTGTATTTTGAATTAAATCTAGTGAGTCTTCTTCATTAGTAGCTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3328
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082667 Nonsense 314 483 6 7
ENSDART00000147149 None None 112 None 3
Genomic Location (Zv9):
Chromosome 14 (position 15280075)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 17142061
GRCz11 14 17447714
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTTGTGTTGCCCACGGGTGACGTGTGGTCACGACCTGACGGCTCTTATT[T/A]GAACAAACTGCTGATCACTCGAGCCAAGGAGGAGGACGCCGGCATGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14717
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082667 Nonsense 435 483 7 7
ENSDART00000147149 None None 112 None 3
Genomic Location (Zv9):
Chromosome 14 (position 15276634)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 17138620
GRCz11 14 17444273
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACCGACCGGCYGATAAAGACTGCATCGCCTCAGTCGCCTACGAGGAGTA[T/A]CTGGCCCAACAGCAGCAACAGCAGCTCCTGCTGGCTCAATCGGCTCCTAA
Associated Phenotype:
Not determined