Busch Lab

ZMP

si:dkey-236e20.6

Ensembl ID:
ENSDARG00000032516
ZFIN ID:
ZDB-GENE-030131-9751
Description:
hypothetical protein LOC321183 [Source:RefSeq peptide;Acc:NP_001073413]
Human Orthologue:
RRP36
Human Description:
ribosomal RNA processing 36 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:21374]
Mouse Orthologue:
Rrp36
Mouse Description:
ribosomal RNA processing 36 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2385053]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa43800 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17913 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4171
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045682 Essential Splice Site 174 320 4 8
ENSDART00000045682 Essential Splice Site 174 320 4 8
Genomic Location (Zv9):
Chromosome 22 (position 15493401)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15321410
GRCz11 22 15347793
KASP Assay ID:
2261-6599.1 (used for ordering genotyping assays)
KASP Sequence:
AAAGCAACGYGTGCCTTTYCTACGAAAAGTGGTTCCTGTAAAGAAAATGG[T/C]ACGTTACAWATTTTCATTTAATTGAAACGACATTTCAAAAATGGACATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19283
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045682 Essential Splice Site 174 320 4 8
ENSDART00000045682 Essential Splice Site 174 320 4 8
Genomic Location (Zv9):
Chromosome 22 (position 15493401)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15321410
GRCz11 22 15347793
KASP Assay ID:
2261-6599.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGCAACGCGTGCCTTTTCTACGAAAAGTGGTTCCTGTAAAGAAAATGG[T/C]ACGTTACATATTTTCATTTAATTGAAACGACATTTCAAAAATGGACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43800
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045682 Essential Splice Site 235 320 7 8
Genomic Location (Zv9):
Chromosome 22 (position 15497080)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15325089
GRCz11 22 15351472
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTAATACTGCAGTTTATTTAATCACTGTGCATATGTGTGTGTAATACA[G/A]GACAACCAGCAGAGGGCCCGACAGAGACAAGAACAGGAGAGAGAAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17913
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045682 Nonsense 298 320 8 8
Genomic Location (Zv9):
Chromosome 22 (position 15497900)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15325909
GRCz11 22 15352292
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCGGAGAAKTACAGYGAGCTTAAAAAGWGTGGAAAACTGGAGAACTTCT[T/A]GAGTAAGAAGAGGAAACGCAACGCYACAAAGGATCGCAGAAAGTTGCCCA
Associated Phenotype:
Not determined