Busch Lab

ZMP

efna3b

Ensembl ID:
ENSDARG00000032485
ZFIN ID:
ZDB-GENE-011108-1
Description:
ephrin A3b [Source:RefSeq peptide;Acc:NP_571929]
Human Orthologues:
EFNA3, RP11-540D14.8
Human Descriptions:
cDNA FLJ57652, highly similar to Ephrin-A3 [Source:UniProtKB/TrEMBL;Acc:B4DXG7]
ephrin-A3 [Source:HGNC Symbol;Acc:3223]
Mouse Orthologue:
Efna3
Mouse Description:
ephrin A3 Gene [Source:MGI Symbol;Acc:MGI:106644]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa22828 Nonsense Available for shipment Available now
sa10600 Nonsense Available for shipment Available now
sa14686 Nonsense Available for shipment Available now
sa2851 Nonsense F2 line generated Not yet available
sa25013 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22828
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103229 Nonsense 8 195 1 6
ENSDART00000121607 None None 219 None 5
ENSDART00000146159 None None 64 None 3
Genomic Location (Zv9):
Chromosome 16 (position 25409935)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23255610
GRCz11 16 23170642
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTTGATTTTCACAAATTCTCAGAAACAAGCATAGCTTACATTGGCAAT[C/G]AATCCACCAGTAAGCCTTTGTCCTTAATTGACCTACAGTATGTTTTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10600
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103229 Nonsense 27 195 3 6
ENSDART00000121607 Nonsense 51 219 2 5
ENSDART00000146159 None None 64 None 3
ENSDART00000103229 Nonsense 27 195 3 6
ENSDART00000121607 Nonsense 51 219 2 5
ENSDART00000146159 None None 64 None 3
Genomic Location (Zv9):
Chromosome 16 (position 25411783)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23257458
GRCz11 16 23172490
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCAGACTTCGTAAGGAGGGCTACACGTTGCAGGTGAATGTCAACGACTA[T/A]CTGGACATCTACTGTCCTCACTACAACAGCAGTCAGAGGGGCATCGCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14686
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103229 Nonsense 27 195 3 6
ENSDART00000121607 Nonsense 51 219 2 5
ENSDART00000146159 None None 64 None 3
ENSDART00000103229 Nonsense 27 195 3 6
ENSDART00000121607 Nonsense 51 219 2 5
ENSDART00000146159 None None 64 None 3
Genomic Location (Zv9):
Chromosome 16 (position 25411783)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23257458
GRCz11 16 23172490
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCAGACTTCGTAAGGAGGGCTACACGTTGCAGGTGAATGTCAACGACTA[T/G]CTGGACATCTACTGTCCTCACTACAACAGCAGTCAGAGGGGCATCGCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2851
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103229 Nonsense 46 195 3 6
ENSDART00000121607 Nonsense 70 219 2 5
ENSDART00000146159 None None 64 None 3
Genomic Location (Zv9):
Chromosome 16 (position 25411840)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23257515
GRCz11 16 23172547
KASP Assay ID:
554-2893.1 (used for ordering genotyping assays)
KASP Sequence:
ATCTACTGTCCTCACTACAACAGCAGTCAGAGGGGCATCGCGGAACAGTA[T/A]GTGCTCTACATGGTCAGTTATCGCGGTTACCGGACCTGTGATCCACAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25013
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103229 Nonsense 70 195 3 6
ENSDART00000121607 Nonsense 94 219 2 5
ENSDART00000146159 None None 64 None 3
Genomic Location (Zv9):
Chromosome 16 (position 25411912)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23257587
GRCz11 16 23172619
KASP Assay ID:
554-7555.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCGGTTACCGGACCTGTGATCCACAGCTAGGCTTCAAGCGCTGGGAGTG[T/A]AACCGTCCTCACGCCCCTCATGCTCCCATCAAATTCTCAGAGAAGTTCCA
Associated Phenotype:
Not determined